ID: 1167703672

View in Genome Browser
Species Human (GRCh38)
Location 19:51065778-51065800
Sequence TGGCTCAGCGGGATGTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703658_1167703672 3 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703662_1167703672 -6 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703663_1167703672 -7 Left 1167703663 19:51065762-51065784 CCCTCTCCACCCCCAGTGGCTCA No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703661_1167703672 -5 Left 1167703661 19:51065760-51065782 CCCCCTCTCCACCCCCAGTGGCT No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703664_1167703672 -8 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703659_1167703672 -2 Left 1167703659 19:51065757-51065779 CCTCCCCCTCTCCACCCCCAGTG No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703652_1167703672 29 Left 1167703652 19:51065726-51065748 CCCAGCTCACTCAGCATTTCCTG No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703656_1167703672 10 Left 1167703656 19:51065745-51065767 CCTGGTCCCTGGCCTCCCCCTCT No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703651_1167703672 30 Left 1167703651 19:51065725-51065747 CCCCAGCTCACTCAGCATTTCCT No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703653_1167703672 28 Left 1167703653 19:51065727-51065749 CCAGCTCACTCAGCATTTCCTGG No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data
1167703657_1167703672 4 Left 1167703657 19:51065751-51065773 CCCTGGCCTCCCCCTCTCCACCC No data
Right 1167703672 19:51065778-51065800 TGGCTCAGCGGGATGTCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703672 Original CRISPR TGGCTCAGCGGGATGTCTCC AGG Intergenic
No off target data available for this crispr