ID: 1167703673

View in Genome Browser
Species Human (GRCh38)
Location 19:51065792-51065814
Sequence GTCTCCAGGCACCCCCGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703670_1167703673 -4 Left 1167703670 19:51065773-51065795 CCCAGTGGCTCAGCGGGATGTCT No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703664_1167703673 6 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703668_1167703673 -2 Left 1167703668 19:51065771-51065793 CCCCCAGTGGCTCAGCGGGATGT No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703669_1167703673 -3 Left 1167703669 19:51065772-51065794 CCCCAGTGGCTCAGCGGGATGTC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703663_1167703673 7 Left 1167703663 19:51065762-51065784 CCCTCTCCACCCCCAGTGGCTCA No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703667_1167703673 1 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703656_1167703673 24 Left 1167703656 19:51065745-51065767 CCTGGTCCCTGGCCTCCCCCTCT No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703658_1167703673 17 Left 1167703658 19:51065752-51065774 CCTGGCCTCCCCCTCTCCACCCC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703659_1167703673 12 Left 1167703659 19:51065757-51065779 CCTCCCCCTCTCCACCCCCAGTG No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703661_1167703673 9 Left 1167703661 19:51065760-51065782 CCCCCTCTCCACCCCCAGTGGCT No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703657_1167703673 18 Left 1167703657 19:51065751-51065773 CCCTGGCCTCCCCCTCTCCACCC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703671_1167703673 -5 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data
1167703662_1167703673 8 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703673 19:51065792-51065814 GTCTCCAGGCACCCCCGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703673 Original CRISPR GTCTCCAGGCACCCCCGACC TGG Intergenic
No off target data available for this crispr