ID: 1167703675

View in Genome Browser
Species Human (GRCh38)
Location 19:51065796-51065818
Sequence AAGCCCAGGTCGGGGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703675_1167703683 -8 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703675_1167703685 -4 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703685 19:51065815-51065837 GCTTGGCCCTCTGCTTGGGGCGG No data
1167703675_1167703682 -9 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703682 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
1167703675_1167703691 23 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703691 19:51065842-51065864 TCCAGGACGTGCTGGGACCTAGG No data
1167703675_1167703689 15 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703689 19:51065834-51065856 GCGGAGCTTCCAGGACGTGCTGG No data
1167703675_1167703688 6 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703675_1167703690 16 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703675_1167703684 -7 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703684 19:51065812-51065834 TGGGCTTGGCCCTCTGCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703675 Original CRISPR AAGCCCAGGTCGGGGGTGCC TGG (reversed) Intergenic