ID: 1167703679

View in Genome Browser
Species Human (GRCh38)
Location 19:51065805-51065827
Sequence CAGAGGGCCAAGCCCAGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703679_1167703690 7 Left 1167703679 19:51065805-51065827 CCCGACCTGGGCTTGGCCCTCTG No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703679_1167703691 14 Left 1167703679 19:51065805-51065827 CCCGACCTGGGCTTGGCCCTCTG No data
Right 1167703691 19:51065842-51065864 TCCAGGACGTGCTGGGACCTAGG No data
1167703679_1167703689 6 Left 1167703679 19:51065805-51065827 CCCGACCTGGGCTTGGCCCTCTG No data
Right 1167703689 19:51065834-51065856 GCGGAGCTTCCAGGACGTGCTGG No data
1167703679_1167703688 -3 Left 1167703679 19:51065805-51065827 CCCGACCTGGGCTTGGCCCTCTG No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703679 Original CRISPR CAGAGGGCCAAGCCCAGGTC GGG (reversed) Intergenic
No off target data available for this crispr