ID: 1167703683

View in Genome Browser
Species Human (GRCh38)
Location 19:51065811-51065833
Sequence CTGGGCTTGGCCCTCTGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703671_1167703683 14 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703662_1167703683 27 Left 1167703662 19:51065761-51065783 CCCCTCTCCACCCCCAGTGGCTC No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703663_1167703683 26 Left 1167703663 19:51065762-51065784 CCCTCTCCACCCCCAGTGGCTCA No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703668_1167703683 17 Left 1167703668 19:51065771-51065793 CCCCCAGTGGCTCAGCGGGATGT No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703669_1167703683 16 Left 1167703669 19:51065772-51065794 CCCCAGTGGCTCAGCGGGATGTC No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703670_1167703683 15 Left 1167703670 19:51065773-51065795 CCCAGTGGCTCAGCGGGATGTCT No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703675_1167703683 -8 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703667_1167703683 20 Left 1167703667 19:51065768-51065790 CCACCCCCAGTGGCTCAGCGGGA No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703661_1167703683 28 Left 1167703661 19:51065760-51065782 CCCCCTCTCCACCCCCAGTGGCT No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data
1167703664_1167703683 25 Left 1167703664 19:51065763-51065785 CCTCTCCACCCCCAGTGGCTCAG No data
Right 1167703683 19:51065811-51065833 CTGGGCTTGGCCCTCTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703683 Original CRISPR CTGGGCTTGGCCCTCTGCTT GGG Intergenic
No off target data available for this crispr