ID: 1167703688

View in Genome Browser
Species Human (GRCh38)
Location 19:51065825-51065847
Sequence CTGCTTGGGGCGGAGCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703679_1167703688 -3 Left 1167703679 19:51065805-51065827 CCCGACCTGGGCTTGGCCCTCTG No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703671_1167703688 28 Left 1167703671 19:51065774-51065796 CCAGTGGCTCAGCGGGATGTCTC No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703677_1167703688 -1 Left 1167703677 19:51065803-51065825 CCCCCGACCTGGGCTTGGCCCTC No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703669_1167703688 30 Left 1167703669 19:51065772-51065794 CCCCAGTGGCTCAGCGGGATGTC No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703675_1167703688 6 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703680_1167703688 -4 Left 1167703680 19:51065806-51065828 CCGACCTGGGCTTGGCCCTCTGC No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703678_1167703688 -2 Left 1167703678 19:51065804-51065826 CCCCGACCTGGGCTTGGCCCTCT No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703670_1167703688 29 Left 1167703670 19:51065773-51065795 CCCAGTGGCTCAGCGGGATGTCT No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data
1167703681_1167703688 -8 Left 1167703681 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
Right 1167703688 19:51065825-51065847 CTGCTTGGGGCGGAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703688 Original CRISPR CTGCTTGGGGCGGAGCTTCC AGG Intergenic
No off target data available for this crispr