ID: 1167703690

View in Genome Browser
Species Human (GRCh38)
Location 19:51065835-51065857
Sequence CGGAGCTTCCAGGACGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167703675_1167703690 16 Left 1167703675 19:51065796-51065818 CCAGGCACCCCCGACCTGGGCTT No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703677_1167703690 9 Left 1167703677 19:51065803-51065825 CCCCCGACCTGGGCTTGGCCCTC No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703679_1167703690 7 Left 1167703679 19:51065805-51065827 CCCGACCTGGGCTTGGCCCTCTG No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703680_1167703690 6 Left 1167703680 19:51065806-51065828 CCGACCTGGGCTTGGCCCTCTGC No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703681_1167703690 2 Left 1167703681 19:51065810-51065832 CCTGGGCTTGGCCCTCTGCTTGG No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703687_1167703690 -10 Left 1167703687 19:51065822-51065844 CCTCTGCTTGGGGCGGAGCTTCC No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703686_1167703690 -9 Left 1167703686 19:51065821-51065843 CCCTCTGCTTGGGGCGGAGCTTC No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data
1167703678_1167703690 8 Left 1167703678 19:51065804-51065826 CCCCGACCTGGGCTTGGCCCTCT No data
Right 1167703690 19:51065835-51065857 CGGAGCTTCCAGGACGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167703690 Original CRISPR CGGAGCTTCCAGGACGTGCT GGG Intergenic
No off target data available for this crispr