ID: 1167704355

View in Genome Browser
Species Human (GRCh38)
Location 19:51070164-51070186
Sequence CTGGGCATGCTTCCATCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167704349_1167704355 9 Left 1167704349 19:51070132-51070154 CCAAGATCTTCTCTTCTCTTGTC No data
Right 1167704355 19:51070164-51070186 CTGGGCATGCTTCCATCTCAGGG No data
1167704348_1167704355 10 Left 1167704348 19:51070131-51070153 CCCAAGATCTTCTCTTCTCTTGT No data
Right 1167704355 19:51070164-51070186 CTGGGCATGCTTCCATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167704355 Original CRISPR CTGGGCATGCTTCCATCTCA GGG Intergenic
No off target data available for this crispr