ID: 1167706848

View in Genome Browser
Species Human (GRCh38)
Location 19:51086266-51086288
Sequence TTCACCGCCGGTGGCTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167706841_1167706848 29 Left 1167706841 19:51086214-51086236 CCTTCAGCTCAAAGGTAGGGAGA No data
Right 1167706848 19:51086266-51086288 TTCACCGCCGGTGGCTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167706848 Original CRISPR TTCACCGCCGGTGGCTCCCA AGG Intergenic