ID: 1167707601

View in Genome Browser
Species Human (GRCh38)
Location 19:51090768-51090790
Sequence TCCTATCTTTGGAAGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167707592_1167707601 12 Left 1167707592 19:51090733-51090755 CCACGTGGAGGTAGTGGGATGCA No data
Right 1167707601 19:51090768-51090790 TCCTATCTTTGGAAGCTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167707601 Original CRISPR TCCTATCTTTGGAAGCTGGG GGG Intergenic
No off target data available for this crispr