ID: 1167708548

View in Genome Browser
Species Human (GRCh38)
Location 19:51096599-51096621
Sequence GGCACACTTGGCACTAGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167708541_1167708548 12 Left 1167708541 19:51096564-51096586 CCATTCCTTATGTCACTGAGCTA No data
Right 1167708548 19:51096599-51096621 GGCACACTTGGCACTAGGACTGG No data
1167708540_1167708548 13 Left 1167708540 19:51096563-51096585 CCCATTCCTTATGTCACTGAGCT No data
Right 1167708548 19:51096599-51096621 GGCACACTTGGCACTAGGACTGG No data
1167708542_1167708548 7 Left 1167708542 19:51096569-51096591 CCTTATGTCACTGAGCTAATGAG No data
Right 1167708548 19:51096599-51096621 GGCACACTTGGCACTAGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167708548 Original CRISPR GGCACACTTGGCACTAGGAC TGG Intergenic
No off target data available for this crispr