ID: 1167708578

View in Genome Browser
Species Human (GRCh38)
Location 19:51096859-51096881
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167708578_1167708585 23 Left 1167708578 19:51096859-51096881 CCCACTCTGTTCCCGCCACACTG No data
Right 1167708585 19:51096905-51096927 AAGCTGATTCCCACCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167708578 Original CRISPR CAGTGTGGCGGGAACAGAGT GGG (reversed) Intergenic
No off target data available for this crispr