ID: 1167711247

View in Genome Browser
Species Human (GRCh38)
Location 19:51112540-51112562
Sequence GCGTCTGGTGGAAGATATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167711241_1167711247 -7 Left 1167711241 19:51112524-51112546 CCATCCTAAGCAATCCGCGTCTG No data
Right 1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG No data
1167711240_1167711247 9 Left 1167711240 19:51112508-51112530 CCAGGTCATCTAGCTGCCATCCT No data
Right 1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG No data
1167711239_1167711247 15 Left 1167711239 19:51112502-51112524 CCATCTCCAGGTCATCTAGCTGC No data
Right 1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG No data
1167711238_1167711247 20 Left 1167711238 19:51112497-51112519 CCTTGCCATCTCCAGGTCATCTA No data
Right 1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG No data
1167711236_1167711247 30 Left 1167711236 19:51112487-51112509 CCTCAGAATGCCTTGCCATCTCC No data
Right 1167711247 19:51112540-51112562 GCGTCTGGTGGAAGATATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167711247 Original CRISPR GCGTCTGGTGGAAGATATGG TGG Intergenic
No off target data available for this crispr