ID: 1167716887

View in Genome Browser
Species Human (GRCh38)
Location 19:51147776-51147798
Sequence CTCTAGACAGTGTTGGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 222}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167716887_1167716897 27 Left 1167716887 19:51147776-51147798 CCCACCCCCAACACTGTCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1167716897 19:51147826-51147848 GGCCAGATAGGAAATATTTTTGG 0: 7
1: 279
2: 915
3: 1700
4: 2090
1167716887_1167716896 15 Left 1167716887 19:51147776-51147798 CCCACCCCCAACACTGTCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1167716896 19:51147814-51147836 ACTATCTGGAAAGGCCAGATAGG 0: 1
1: 0
2: 1
3: 10
4: 110
1167716887_1167716895 6 Left 1167716887 19:51147776-51147798 CCCACCCCCAACACTGTCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1167716895 19:51147805-51147827 CCAGAAAATACTATCTGGAAAGG 0: 1
1: 0
2: 0
3: 27
4: 243
1167716887_1167716893 1 Left 1167716887 19:51147776-51147798 CCCACCCCCAACACTGTCTAGAG 0: 1
1: 0
2: 0
3: 13
4: 222
Right 1167716893 19:51147800-51147822 AGAAGCCAGAAAATACTATCTGG 0: 1
1: 0
2: 1
3: 20
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167716887 Original CRISPR CTCTAGACAGTGTTGGGGGT GGG (reversed) Intronic
900661829 1:3788500-3788522 CTCTGAACAGAGTTGGGGATGGG + Intronic
901145061 1:7059175-7059197 CTCTAGACAGGTTTGGGAGAAGG + Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902394905 1:16127306-16127328 CTCTAGACAGAGCCTGGGGTTGG + Intronic
903716250 1:25369408-25369430 CTCTAGTCAATGCTGTGGGTAGG - Intronic
904187115 1:28714204-28714226 CTCAAGACAGTGGTGGAGGCTGG - Exonic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
907626461 1:56035231-56035253 CTCTAGAGGGTGTTGGAGGAGGG - Intergenic
909013727 1:70361444-70361466 GTCTAGTCAGTGTTTGGTGTTGG - Intronic
909609070 1:77534173-77534195 CTGTAGAAAGTGTGTGGGGTGGG - Intronic
913650602 1:120911221-120911243 CTCTGGAGACTGTTGTGGGTTGG - Intergenic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
915653070 1:157333785-157333807 GGCTAGAGAGTGATGGGGGTGGG - Intergenic
915684494 1:157617698-157617720 GGCTAGAGAGTGATGGGGGTGGG + Intergenic
915931034 1:160061152-160061174 TTGTAGATAGGGTTGGGGGTGGG + Intronic
916520779 1:165561628-165561650 CTCTAGACAGTGTGGGATGGTGG - Intronic
916894530 1:169148760-169148782 GACTGGACAGTGTTGGTGGTTGG + Intronic
916913945 1:169385387-169385409 CTATACACAGTGTGGGGGATGGG - Intronic
917267874 1:173241185-173241207 CTCTGGAATGTGTTGGGGTTGGG - Intergenic
917367903 1:174253986-174254008 CTCTAGACTGGGATGAGGGTGGG + Intronic
919766660 1:201131860-201131882 TCCCAGACAGTATTGGGGGTTGG + Intergenic
919874850 1:201857112-201857134 TTCTACAAATTGTTGGGGGTTGG - Exonic
920510103 1:206544712-206544734 GGCTTGACAGTGTTTGGGGTTGG - Intronic
920607050 1:207399040-207399062 CTGGAGCCAGTGGTGGGGGTGGG + Intergenic
922333436 1:224598016-224598038 CACAACACAATGTTGGGGGTGGG - Intronic
1063350055 10:5346051-5346073 CTCTATCCAGTGTTGGGGCCAGG - Intergenic
1065400277 10:25292171-25292193 TAATAGACAGTGGTGGGGGTGGG + Intronic
1066809601 10:39310951-39310973 CTCTGGAGACTGTTGTGGGTTGG - Intergenic
1067756313 10:49008446-49008468 CTCTGGACAATGTTGTGGTTTGG + Intergenic
1068802738 10:61160884-61160906 TTCTAGACACTGTTGGGAATTGG - Intergenic
1068929099 10:62570204-62570226 ATCTACAGTGTGTTGGGGGTGGG + Intronic
1069709718 10:70480477-70480499 TCCTGGCCAGTGTTGGGGGTGGG + Intronic
1069717122 10:70528442-70528464 CTCAGGACAGTCTTGGGGGTAGG + Intronic
1072267008 10:93740518-93740540 CTCCAGACAGTGATTTGGGTGGG - Intergenic
1073330580 10:102667820-102667842 AGCTGGAAAGTGTTGGGGGTGGG + Intergenic
1077158185 11:1100798-1100820 GTCTGCACAGTGCTGGGGGTGGG - Intergenic
1077286525 11:1768423-1768445 ATATAGACAGGGGTGGGGGTGGG + Intergenic
1078091900 11:8269122-8269144 CTCAAGACAAGGGTGGGGGTGGG + Intergenic
1078781539 11:14443609-14443631 CTCTGGAAGGTGTTGGGGGCGGG - Intronic
1078820195 11:14872273-14872295 CTCTAGAGTGTGTAGGGGATAGG + Intergenic
1080852440 11:36081459-36081481 CTCTAGACAATGTGGCGTGTGGG + Intronic
1081984244 11:47290049-47290071 ATGTGGTCAGTGTTGGGGGTAGG + Exonic
1084608318 11:70185395-70185417 CTCTCCACAGTGGAGGGGGTTGG - Intronic
1085025928 11:73236612-73236634 CTCAAGGCAGGGTTGGGGCTGGG + Intergenic
1087190983 11:95254185-95254207 TTCTAGAGGCTGTTGGGGGTTGG + Intergenic
1090265302 11:125349683-125349705 CTCTGCACAGAGTTGGTGGTTGG + Intronic
1091617715 12:2062382-2062404 ACCCAGACAGTGTTGGGGCTGGG + Intronic
1091663121 12:2399176-2399198 CACTAGACATTGTTGTGGGCAGG - Intronic
1092383731 12:8019304-8019326 CTCTATAGAGTTTTGGGGTTAGG + Intergenic
1095251569 12:39985156-39985178 CTCGAGACAGTGTTTGGAGATGG - Intronic
1095768989 12:45929904-45929926 TTTTTGACTGTGTTGGGGGTTGG - Intronic
1096997248 12:55846302-55846324 TTGTAGAGAGTGTGGGGGGTGGG + Intergenic
1097701740 12:62827483-62827505 CTCAAGACAGTGATGGCAGTGGG - Intronic
1100572137 12:95852723-95852745 CACTAGTAAGTGTTGGGGGCAGG + Intergenic
1103173331 12:118841246-118841268 AACTAGTCAGTGTTGGAGGTGGG - Intergenic
1106118697 13:26839304-26839326 CTCGAGCCAGTGCTGGTGGTAGG - Intergenic
1106407405 13:29485909-29485931 CTCCAAACAGTGTGTGGGGTGGG + Intronic
1111250881 13:85599791-85599813 CTCTACACAATGCTGGAGGTTGG + Intergenic
1112622577 13:101066958-101066980 CTATAGACAGTAGTTGGGGTTGG - Intronic
1113519295 13:110927655-110927677 CACTGGAGCGTGTTGGGGGTGGG + Intergenic
1114728891 14:24969499-24969521 CTATAGACATTGTTGTGGGTAGG + Intronic
1115186937 14:30699475-30699497 CTCTGGACAGTCTTGGGCTTTGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121220961 14:92285090-92285112 CTCTTGACAGGGTTGGAGGGGGG + Intergenic
1122378750 14:101286727-101286749 CTCTAGTCAGAGCTGGGGGTGGG - Intergenic
1122859789 14:104577407-104577429 CTCCAGGCAGGGTCGGGGGTGGG - Intronic
1122903206 14:104790442-104790464 CTCTAACCAGTGTTGCGGGTGGG + Intronic
1123934426 15:25187281-25187303 CTCTATACAGGGAAGGGGGTGGG - Intergenic
1124604961 15:31162948-31162970 CTCTTGAGAGTGTTGGAGGGTGG + Intergenic
1125534696 15:40436411-40436433 CTCTAGGGAGTGGTAGGGGTGGG + Intergenic
1126318638 15:47398032-47398054 CTAGGGAAAGTGTTGGGGGTTGG - Intronic
1127551416 15:60042678-60042700 CTCTATACAGTGGTTGTGGTGGG + Intronic
1128291953 15:66484827-66484849 GTAAACACAGTGTTGGGGGTAGG + Intronic
1129514038 15:76145731-76145753 CTCTAGACATTGTTTGGTTTGGG + Intronic
1130293098 15:82622196-82622218 CACTAGACAGTTGTTGGGGTAGG + Intronic
1131147612 15:90024364-90024386 CACCAGACTATGTTGGGGGTGGG + Intronic
1131969750 15:97879969-97879991 CCCCAGTCAGTGTTGGAGGTGGG - Intergenic
1133390855 16:5408793-5408815 AGCAAGACAGAGTTGGGGGTTGG + Intergenic
1134415405 16:14039190-14039212 CTCTAGTAAGTGTTGGCTGTTGG + Intergenic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1138019618 16:53466335-53466357 CCATGGACAGGGTTGGGGGTTGG + Intronic
1138561101 16:57801642-57801664 CTTGAGACAGTGTTGGGGTATGG + Intronic
1139021288 16:62753102-62753124 CTCTGGACAATGCTGGGGGAGGG - Intergenic
1140093604 16:71856597-71856619 ATCTAGATTGTGTTGGGGGAGGG + Exonic
1140277497 16:73523578-73523600 ATTTACACAGTGCTGGGGGTAGG + Intergenic
1142713465 17:1735879-1735901 CTCTGGCCTGTGATGGGGGTGGG + Intronic
1143993718 17:10988924-10988946 CTTTAGAAAGTGCTGGGGGCAGG + Intergenic
1145230327 17:21169304-21169326 CTTCAGACAGTCTTGGGAGTCGG + Intronic
1145262831 17:21365056-21365078 CCCCAGACAATGCTGGGGGTGGG + Intergenic
1149774026 17:59343345-59343367 CTGTAGACACTACTGGGGGTGGG + Intronic
1151105873 17:71616681-71616703 TTGTAGACAGTGTTAGGGATAGG - Intergenic
1151362005 17:73594440-73594462 CCCTGGAAAGTGTTGGTGGTGGG + Intronic
1151836620 17:76586267-76586289 CTCTAGACTCTGTGGCGGGTGGG + Intronic
1154054615 18:11000945-11000967 TTCTGGTCAGTGCTGGGGGTGGG - Intronic
1155464418 18:26119883-26119905 CTCTAGACAGCTTTGTGTGTTGG - Intergenic
1157463100 18:47919285-47919307 CTGGAGAGTGTGTTGGGGGTGGG - Intronic
1157609903 18:48949774-48949796 CTCCGGAAAATGTTGGGGGTAGG + Intronic
1157874938 18:51263836-51263858 CTCAAGAATGGGTTGGGGGTAGG - Intergenic
1158032492 18:52983052-52983074 CTCTATAAAGTGTCTGGGGTTGG + Intronic
1158083908 18:53626877-53626899 GCCTAAACAGTGTTGGGGTTTGG + Intergenic
1158388140 18:57018231-57018253 CTCTACACAGAGTTGGGCTTTGG + Intronic
1158488266 18:57887606-57887628 CTCAAAACAGTGCTGGGGCTCGG + Intergenic
1159032516 18:63246022-63246044 CTCTAGAGAGTGGGTGGGGTGGG + Intronic
1160847578 19:1173353-1173375 CTGCAGAGCGTGTTGGGGGTGGG - Intronic
1161293574 19:3508089-3508111 CTGCAGGCAGTGGTGGGGGTAGG + Intronic
1163641005 19:18461942-18461964 CTATAGACAGTGCTGGTGGGAGG + Intronic
1163760318 19:19132901-19132923 CTCTAGCCAGTCCTGTGGGTGGG - Intronic
1164539838 19:29114251-29114273 CTCTAGAAGGTGATGGGGCTGGG + Intergenic
1165712069 19:38018861-38018883 CTCTGGACACTGTGTGGGGTAGG - Intronic
1165899231 19:39161079-39161101 CTCTAAACAGTGCTGGGTGCTGG - Intronic
1167263826 19:48473670-48473692 CGCTAGACAGGTCTGGGGGTTGG - Intronic
1167492793 19:49801872-49801894 CTCACCACAGTGCTGGGGGTGGG - Exonic
1167716887 19:51147776-51147798 CTCTAGACAGTGTTGGGGGTGGG - Intronic
926393608 2:12419123-12419145 CTCTAAACTGTGCTGGGGGGTGG + Intergenic
926429819 2:12774400-12774422 TTTTAGACATTGTTGAGGGTGGG + Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
929346222 2:40887758-40887780 CTACAGACAGAGTCGGGGGTGGG - Intergenic
929835763 2:45396997-45397019 CTCTTGAAAGTGTTGAGAGTGGG - Intronic
932781936 2:74564442-74564464 CACTAGAAGGTTTTGGGGGTGGG + Intronic
937424763 2:121789734-121789756 CTCTACATAGTGGTGGGGCTGGG - Intergenic
938029458 2:127980267-127980289 TTTTGGCCAGTGTTGGGGGTGGG - Intronic
939366703 2:141242443-141242465 TTCTAGACAGTGTTGGGGTCAGG - Intronic
940259299 2:151763946-151763968 CTCTAGGCAGTGTTGAGGACGGG - Intergenic
946374584 2:219300287-219300309 CTCTGGACAGTGCTGGGGGAAGG + Intronic
946820788 2:223627286-223627308 TTCTAGACAGTAGTGGGGGTTGG + Intergenic
1168975273 20:1961151-1961173 TCCTAGACAGAGGTGGGGGTGGG + Intergenic
1170243590 20:14196041-14196063 CCCTAGACACTGCTGGGGGTCGG + Intronic
1171233682 20:23507948-23507970 CTCTGGACAGTGTGGGGGTGGGG - Intergenic
1172043324 20:32061563-32061585 GGCTAGACAGTGATGGGAGTTGG + Intronic
1173444866 20:43108555-43108577 CTCGAGACAGGGTTGGGGGCGGG + Intronic
1173790476 20:45824703-45824725 CTCTAGGCAGGGTGGGGGTTGGG - Intronic
1173833775 20:46111589-46111611 CTGGAGACAGTGCAGGGGGTGGG + Intergenic
1173957977 20:47049401-47049423 CTCTCCACATTGTTGGAGGTGGG + Intronic
1174178498 20:48659653-48659675 CTCTATACAGTGTACGGGGAGGG + Intronic
1174443017 20:50570908-50570930 CTCTAGATGGTATTGAGGGTTGG + Intronic
1175423839 20:58852244-58852266 CCCTAGAGTGTGATGGGGGTGGG + Intronic
1177791981 21:25732098-25732120 CTCAAAATAGGGTTGGGGGTGGG + Intronic
1179887097 21:44318870-44318892 CTGTAGGCAGTGGTGGGAGTTGG + Intronic
1180694358 22:17742487-17742509 CACTAGACCGGGGTGGGGGTGGG - Intronic
1181617023 22:24061881-24061903 CTCTTCACAGTGTGGGGGGTAGG - Intronic
1183507241 22:38215885-38215907 GTGTGGACAGTGTTGGGGGAGGG - Exonic
949724705 3:7030359-7030381 CCCTAGACACTTTTGGGGGTGGG + Intronic
950761036 3:15226948-15226970 CTCTAGAAAGGGTTTGGGGATGG + Intronic
954929593 3:54269580-54269602 CTTTACACAGTGATGGTGGTTGG - Intronic
958132200 3:89441987-89442009 CTGTAGACAGTGTTTGCTGTTGG + Intronic
958441929 3:94165581-94165603 CTCTAGGCAGGGTGTGGGGTGGG - Intergenic
959563329 3:107807802-107807824 CCTTAGGCAGGGTTGGGGGTGGG + Intronic
959938170 3:112052147-112052169 CTATAGCCTGAGTTGGGGGTGGG + Intronic
959938365 3:112054226-112054248 CTCTAGTCAGTGATGGTGATAGG - Intronic
960539212 3:118845898-118845920 CTCTGGACACTGTTGTGGGGTGG + Intergenic
960558052 3:119050981-119051003 CTCTGGGGAGTGTTGTGGGTTGG + Intronic
961826474 3:129601790-129601812 CTCTGGACAGATTTGGGGGCTGG - Intronic
962567340 3:136674932-136674954 CTCTAGCAAAAGTTGGGGGTTGG + Intronic
963025341 3:140913577-140913599 CTTTTGTCAGGGTTGGGGGTTGG - Intergenic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
969638075 4:8380884-8380906 CCCTAGACAGGGTGGGGGCTGGG + Intronic
971454823 4:26834426-26834448 TCATGGACAGTGTTGGGGGTTGG + Intergenic
975120452 4:70722604-70722626 ATCTTGTCAGTGGTGGGGGTTGG - Exonic
977621520 4:99142823-99142845 ATTTTGACAGGGTTGGGGGTAGG + Intronic
978291742 4:107150211-107150233 GTCTATACATTGTTGAGGGTTGG + Intronic
978337628 4:107686802-107686824 CACTAGCCAGAGTTGGGGCTCGG - Intronic
980023772 4:127740301-127740323 CTGTAGACAGTGTTGGGTAGGGG + Intronic
983559144 4:169083922-169083944 CTGAAGAGAGTGTTGGGGGCTGG + Intergenic
984423471 4:179553992-179554014 TTCTGCACAGGGTTGGGGGTAGG + Intergenic
986732073 5:10642371-10642393 TTCTAGACTGTGATGGGGGATGG - Intronic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987742537 5:21928515-21928537 CTCTAGACAATGTCAGGAGTTGG + Intronic
992189783 5:74280481-74280503 CTCTAGAGGGTGCTGGTGGTTGG - Intergenic
992844567 5:80733079-80733101 ATCAAGACAGTGTGGAGGGTGGG + Intronic
994356192 5:98796339-98796361 CTCGACACACTGTTGGGGGGGGG - Exonic
996831273 5:127743171-127743193 GTCTAGGCAGTCTTGGTGGTTGG - Intergenic
997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG + Intergenic
997665667 5:135627902-135627924 CTCTATGCATGGTTGGGGGTGGG + Intergenic
999232238 5:150068538-150068560 CTCTGGACAGGGTTTGGGGCTGG - Intronic
1000015885 5:157275600-157275622 ATCAAGACAATCTTGGGGGTGGG - Intronic
1000569150 5:162890107-162890129 CTCAAGACAATGTTAAGGGTAGG + Intergenic
1001603057 5:172941529-172941551 CCTGAGACAGTGCTGGGGGTAGG - Intronic
1004689787 6:17983464-17983486 AGCAAGACAGTTTTGGGGGTGGG - Intronic
1005681990 6:28217104-28217126 CTCTAGGGTGTGGTGGGGGTGGG + Intergenic
1005870528 6:29971608-29971630 CCCTGGACAGAGTTGGGGGTCGG + Intergenic
1006180670 6:32151765-32151787 CTGGAGACAGTGGAGGGGGTGGG + Intronic
1006269769 6:32955121-32955143 CTCTAAACAGTGTCGGTGGCTGG - Intronic
1006856201 6:37134919-37134941 CTCTATGCAGGGATGGGGGTGGG + Intergenic
1007064342 6:38974715-38974737 CAATAGTCAGGGTTGGGGGTTGG - Intronic
1007163757 6:39813265-39813287 CTCTAGTGAGTTTTTGGGGTGGG + Intronic
1007503730 6:42318282-42318304 CTGTATTCAGTGTTGGGGGCTGG - Intronic
1007725751 6:43914768-43914790 CTCTGGTGAGTGTTGGGGCTGGG - Intergenic
1014175934 6:118331267-118331289 CTCTAGAAACTGTCAGGGGTAGG - Intergenic
1016030637 6:139333736-139333758 CTTTACACAGTTTTGGAGGTTGG - Intergenic
1021172876 7:17417340-17417362 CTGTAGAAAGGGTTGGGGTTTGG - Intergenic
1023086547 7:36575502-36575524 CTCTAGGGAGTGTTGAGGGAGGG - Intronic
1023519870 7:41039482-41039504 ATCTAGAATGTGTTTGGGGTTGG + Intergenic
1024045780 7:45584673-45584695 CTCTAGACTGTGTGGTAGGTGGG - Intronic
1024231735 7:47368429-47368451 CTCCAGACAGCGTGGGAGGTGGG - Exonic
1026796445 7:73369020-73369042 CTCTAAACTGGGTTGGGGGCTGG - Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1028102948 7:86844048-86844070 CTCTAGATTCTTTTGGGGGTTGG + Intronic
1028770667 7:94617015-94617037 CTCTAGCAGGTGTTGGGTGTTGG + Intronic
1028862942 7:95675130-95675152 CACTAAGCAGTGTAGGGGGTGGG - Intergenic
1029515770 7:101022084-101022106 CCCTAGACAGGGATGGGGGGAGG - Intronic
1032159512 7:129500016-129500038 CCCTAGATGGGGTTGGGGGTTGG - Intergenic
1032521112 7:132545951-132545973 CACTGGTCAGTTTTGGGGGTTGG - Intronic
1032754074 7:134871645-134871667 CTGCAGACAGTGTGGGGGATGGG + Intronic
1037514744 8:19619235-19619257 TTCTAGACAGGGTCGGGGGGGGG + Intronic
1038425199 8:27460212-27460234 GTCTGGACAGAGTTGGGGGGAGG + Exonic
1038938832 8:32281525-32281547 CAATAGACACTGTTGGGGGGAGG - Intronic
1042837637 8:73092624-73092646 CTCTGGTCTGTCTTGGGGGTGGG + Intronic
1048799979 8:138186433-138186455 CTCCTGCCAGTGGTGGGGGTGGG - Intronic
1049478899 8:142810665-142810687 CTCTAGCCAGTGCAGGGGGCAGG + Intergenic
1049559854 8:143304542-143304564 AGCAAGACAGTGTTGGAGGTGGG - Intronic
1049674077 8:143882131-143882153 CTCTAAACTGTGTTGGGGTGGGG - Intergenic
1051273195 9:15374858-15374880 CTATGGCCACTGTTGGGGGTAGG - Intergenic
1052340744 9:27361980-27362002 CTGTAGCCAGTGTGGAGGGTAGG - Intronic
1055542928 9:77333078-77333100 CTCTAGAGAGGATTTGGGGTGGG + Intronic
1056733611 9:89185817-89185839 CTCACCACAGTGTTGGGGGGTGG + Intergenic
1056999808 9:91497296-91497318 CACCAGACTGTCTTGGGGGTTGG - Intergenic
1057314787 9:93961240-93961262 CTATAGCCTGTGTAGGGGGTGGG + Intergenic
1057621055 9:96635587-96635609 CCTTAAACAATGTTGGGGGTAGG + Intergenic
1059826506 9:118035589-118035611 ATCTGGACAGTGTTGGAGGGTGG - Intergenic
1060199957 9:121646517-121646539 CTCTGGGCAGGGGTGGGGGTGGG - Intronic
1061478257 9:130883616-130883638 CACTAGAGAGTGATGTGGGTGGG - Intronic
1061713672 9:132505199-132505221 ATCTAGACATGGATGGGGGTTGG - Intronic
1062602353 9:137323623-137323645 CCCTAGACAGTGGTGGGTCTGGG - Intronic
1190504891 X:51117700-51117722 CTCTAGGGACTGTTGTGGGTTGG + Intergenic
1192289427 X:69777246-69777268 CTCTAGTGAATGTTGGGGGTGGG + Intronic
1192445514 X:71208205-71208227 CACTTCACAGTGTTGGGGCTGGG - Intergenic
1193621398 X:83756473-83756495 CTCTGGGGACTGTTGGGGGTTGG + Intergenic
1198411007 X:136368101-136368123 TTCTCCACCGTGTTGGGGGTTGG - Intronic
1199687811 X:150280155-150280177 CTGAAAACAGTGGTGGGGGTTGG - Intergenic
1199982693 X:152929466-152929488 CTCTCAACAGTGTGGTGGGTGGG + Intronic
1200698605 Y:6383128-6383150 CTTTAGACAGTTTTTGTGGTTGG + Intergenic
1201035509 Y:9781571-9781593 CTTTAGACAGTTTTTGTGGTTGG - Intergenic
1202251309 Y:22876380-22876402 CTCTTGAGACTGTTGTGGGTTGG + Intergenic
1202404297 Y:24510129-24510151 CTCTTGAGACTGTTGTGGGTTGG + Intergenic
1202466482 Y:25159953-25159975 CTCTTGAGACTGTTGTGGGTTGG - Intergenic