ID: 1167718803

View in Genome Browser
Species Human (GRCh38)
Location 19:51163152-51163174
Sequence ATTGATCAAGAAATGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167718798_1167718803 25 Left 1167718798 19:51163104-51163126 CCAATAGAATGAGACCAGAATCG No data
Right 1167718803 19:51163152-51163174 ATTGATCAAGAAATGGAGAAAGG No data
1167718801_1167718803 11 Left 1167718801 19:51163118-51163140 CCAGAATCGGCAAAGCGGAGAAG No data
Right 1167718803 19:51163152-51163174 ATTGATCAAGAAATGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167718803 Original CRISPR ATTGATCAAGAAATGGAGAA AGG Intergenic
No off target data available for this crispr