ID: 1167719115

View in Genome Browser
Species Human (GRCh38)
Location 19:51166597-51166619
Sequence TTTTACGTGAAGATGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167719112_1167719115 30 Left 1167719112 19:51166544-51166566 CCGAAAAGGAGTTTCTTCTACAC No data
Right 1167719115 19:51166597-51166619 TTTTACGTGAAGATGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167719115 Original CRISPR TTTTACGTGAAGATGCTGCA TGG Intergenic
No off target data available for this crispr