ID: 1167719599

View in Genome Browser
Species Human (GRCh38)
Location 19:51169290-51169312
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 7, 1: 20, 2: 47, 3: 103, 4: 241}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167719599_1167719604 9 Left 1167719599 19:51169290-51169312 CCAGATAACTGCAGGTGGGCCTG 0: 7
1: 20
2: 47
3: 103
4: 241
Right 1167719604 19:51169322-51169344 AGGCCCTCCACAAGAGGTGGAGG 0: 178
1: 123
2: 43
3: 46
4: 138
1167719599_1167719603 6 Left 1167719599 19:51169290-51169312 CCAGATAACTGCAGGTGGGCCTG 0: 7
1: 20
2: 47
3: 103
4: 241
Right 1167719603 19:51169319-51169341 GTCAGGCCCTCCACAAGAGGTGG 0: 177
1: 128
2: 50
3: 45
4: 117
1167719599_1167719602 3 Left 1167719599 19:51169290-51169312 CCAGATAACTGCAGGTGGGCCTG 0: 7
1: 20
2: 47
3: 103
4: 241
Right 1167719602 19:51169316-51169338 TGAGTCAGGCCCTCCACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167719599 Original CRISPR CAGGCCCACCTGCAGTTATC TGG (reversed) Intergenic
900125220 1:1066029-1066051 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
900664621 1:3806420-3806442 TAGGCTCGCCCGCAGTTATCCGG - Intergenic
900957242 1:5893647-5893669 CATGCTCGCCTGCAGTTATCCGG - Intronic
901040994 1:6363426-6363448 CAGGCCTGCCCGCAGTTATCCGG + Intronic
901290073 1:8117173-8117195 CAGGCCCACCTCCAGGCCTCTGG - Intergenic
901834161 1:11912913-11912935 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
904466458 1:30710936-30710958 CAGGCCCAGCCTCAGGTATCAGG + Intergenic
905708993 1:40085074-40085096 CAGGCCCGCCTGCAGTTATCCGG + Intronic
906086449 1:43139226-43139248 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
907288834 1:53399651-53399673 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
907294977 1:53444949-53444971 CAGGCCCGCCTGCAGGCATCTGG + Intergenic
908398355 1:63746804-63746826 TAGGCCCACCTGCAGGCCTCTGG + Intergenic
908818540 1:68058431-68058453 CAGGCCCACCTGCAGTTTTCTGG + Intergenic
911127613 1:94355023-94355045 CATGCCCACCTGCAGGGACCAGG + Intergenic
911958076 1:104263127-104263149 CAGGCTCGCCCGCAGTTTTCCGG - Intergenic
912561828 1:110556515-110556537 CAGGCCCATCTGCAGAAAACAGG - Intergenic
914378850 1:147098344-147098366 CAGGCTCGCCCGCAGTTATCTGG - Intergenic
915481907 1:156192628-156192650 CAGGCCCGCCCGCGGTTATCCGG + Intergenic
922413454 1:225397614-225397636 CAGGCACACCTGGAGTCACCTGG + Intronic
923863474 1:237915777-237915799 CAGGCTTGCCTGCAGTTATCCGG + Intergenic
923864004 1:237919475-237919497 CAGGCTTGCCTGCAGTTATCCGG - Intergenic
924759561 1:246971387-246971409 CAGGCCCACCCACAGCTATCCGG - Intronic
1063362292 10:5468512-5468534 CAGCCCCACCTGCTGCTCTCTGG + Intergenic
1063787533 10:9402441-9402463 CAGGCCTGCCTGCAGTTATCTGG + Intergenic
1063985240 10:11494912-11494934 CAGGCTCGCCTGCAGTTATCCGG - Intronic
1064018804 10:11793142-11793164 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1067673350 10:48346630-48346652 CAGGCTCTCCCACAGTTATCCGG + Intronic
1068192252 10:53667270-53667292 CAGGCACACCTCCAGGCATCTGG + Intergenic
1069797523 10:71062876-71062898 CCGGCCCCCCTGCAGTTCCCTGG + Intergenic
1070170763 10:73931175-73931197 CAGGCCTGCCTTCAGTCATCCGG - Intergenic
1071573093 10:86708638-86708660 CAGGCCCACCTGCCCTTCTCTGG - Intronic
1072068576 10:91894403-91894425 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1072439406 10:95440420-95440442 CTGCCCCACCTGCAGGTCTCAGG + Intronic
1072499117 10:95994489-95994511 CAGGCCTGCCTGCAGTCATCCGG - Intronic
1072818999 10:98537793-98537815 CAGGCCTGCCTGCAGTCATCCGG + Intronic
1072863290 10:99029785-99029807 CAGGCTTGCCCGCAGTTATCCGG - Intronic
1073928384 10:108544490-108544512 CAGGCCCACCCACAGCCATCCGG - Intergenic
1074188975 10:111119444-111119466 CAAGTCCACATGCAGTTTTCTGG - Intergenic
1074976763 10:118587449-118587471 CAGGCCCACCAGCTGTTCTCTGG - Intergenic
1076316909 10:129548722-129548744 CAGTCCCACCTGCAGCTTTCGGG + Intronic
1076419632 10:130321746-130321768 CAGGCTCACCCGCAGTTATCCGG + Intergenic
1076894786 10:133305090-133305112 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1076896304 10:133314195-133314217 CAGGCCCGCCCGCAGCCATCTGG + Intronic
1076906997 10:133367644-133367666 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1076912298 10:133397044-133397066 CAGGCCTGCCCGCAGTTATCCGG + Intronic
1076918352 10:133438127-133438149 CAAACCCACCTGCAGCCATCCGG + Intergenic
1076927155 10:133497360-133497382 CAGGCCCACCCACAGTTATTCGG - Intergenic
1077006772 11:361865-361887 CAGACCTGCCCGCAGTTATCCGG - Intergenic
1077264994 11:1644175-1644197 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1077388335 11:2286367-2286389 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1077499559 11:2903029-2903051 CTGGCCCACCTGCAGGGGTCGGG + Intronic
1077520089 11:3027947-3027969 CAGGCTCGCCCGCAGTTATCCGG + Intronic
1077706652 11:4493221-4493243 CAGGCCCACCCACAGCCATCTGG - Intergenic
1077929108 11:6711931-6711953 CAGGCCCGCCCGCAGTTATCTGG + Intergenic
1078546274 11:12249300-12249322 CAGACCCACCTGCAGGGCTCTGG + Intronic
1079621804 11:22564847-22564869 AAGTCCCACCTGGAGTAATCAGG - Intergenic
1080070894 11:28085334-28085356 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1080784739 11:35464443-35464465 CAGGCCCCACAACAGTTATCTGG - Intronic
1082580070 11:54855444-54855466 CAGGCTTGCCCGCAGTTATCCGG + Intergenic
1082954145 11:58850816-58850838 CAGGCCCACCCACAGTTATCTGG + Intronic
1083349422 11:62016798-62016820 CAGGACTGCCTGCAGTTATCTGG + Intergenic
1083502974 11:63128479-63128501 CAGGCCCACCTGCAGTTATCCGG + Intronic
1083591419 11:63897550-63897572 AAGCCCCACCTCCAGTTCTCTGG + Intronic
1084171470 11:67403115-67403137 CAGGCCCACTTCCAGTTCTGAGG - Intronic
1084217717 11:67659393-67659415 CAGGCCCACCTACAGCCATCTGG - Intergenic
1084276108 11:68051767-68051789 CAGATCCACCTGCAGCTCTCCGG - Intergenic
1085471722 11:76762868-76762890 GAGGCCCATCTGCAGTGCTCTGG - Intergenic
1086160700 11:83718905-83718927 TAGTCCCAGCTGCAGTTGTCTGG - Intronic
1088159700 11:106854692-106854714 CAGGCCAATATGCAGGTATCCGG + Intronic
1091593163 12:1857369-1857391 CAGGCCCATCAGCAGTGATGTGG + Intronic
1092444164 12:8538191-8538213 CAGGCTTGCCCGCAGTTATCCGG + Intronic
1094477346 12:30851413-30851435 CAGGCCCGCCCGCAGCCATCCGG + Intergenic
1097591697 12:61582660-61582682 CAGGCTCGCCTGCGGTTATCCGG - Intergenic
1098677995 12:73315528-73315550 CAGGCCCACCTCCAGGAATCTGG - Intergenic
1098935366 12:76472850-76472872 CAGGCCTGCCCACAGTTATCTGG - Intronic
1101390331 12:104294145-104294167 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1101776514 12:107799444-107799466 CAGACTCGCCTGCAGTTATCAGG - Intergenic
1104771651 12:131367726-131367748 CAGGCCCACCTGCAGACATCAGG + Intergenic
1104795843 12:131516898-131516920 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
1104871492 12:132001521-132001543 CAGGCCCACGCACAGTTATCCGG - Intronic
1104878249 12:132051731-132051753 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1104885148 12:132102997-132103019 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1104913758 12:132253252-132253274 CAGGCCTGCCCGCAGTCATCCGG - Intronic
1105019940 12:132809326-132809348 CAGGCCTGCCCGCAGTTATCCGG - Intronic
1105020158 12:132810816-132810838 CAGGCCCGCGCACAGTTATCCGG + Intronic
1105043094 12:132977269-132977291 CAAGCCCGCCCGCAGTCATCCGG + Intergenic
1105287122 13:19013533-19013555 CAGGCCCACCCACAGTTATCCGG + Intergenic
1105856344 13:24375888-24375910 CAGGCTTGCCTGCAGTTATCCGG + Intergenic
1105876139 13:24555037-24555059 CAGGCCCACCCGCAGTTATCTGG - Intergenic
1106715889 13:32387594-32387616 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1107478381 13:40763397-40763419 CAGGGCCACATGCAGTTTCCAGG + Intronic
1110686759 13:78384622-78384644 GAGGGCCATCTGCAGTTAACAGG - Intergenic
1112014121 13:95317290-95317312 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
1112038718 13:95523809-95523831 CAGCCCCAACAACAGTTATCTGG - Intronic
1113775395 13:112942126-112942148 CAGGCCCACCCGCAGTTATCTGG + Intronic
1113856777 13:113450862-113450884 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1113880322 13:113621845-113621867 CAGGCTCGCCTGCAGTTATCTGG + Intronic
1114023329 14:18501101-18501123 CAGATCCCCCTGCAGTTTTCTGG - Intergenic
1114165781 14:20216963-20216985 CAGGCTTGCCCGCAGTTATCTGG - Intergenic
1114658119 14:24328313-24328335 CAGGCTCACCCACAGTTATCCGG + Intronic
1115176030 14:30562669-30562691 CAGGCCCACCCGCAGTTACCTGG + Intronic
1115821279 14:37214948-37214970 CAGGCCCACCCGCAGTTATCCGG + Intronic
1116317659 14:43417918-43417940 CATGTCCACCTGCACTTATTAGG - Intergenic
1119421639 14:74510913-74510935 CAGGCCCTTCTGCAGTTCCCAGG - Intronic
1120986837 14:90342477-90342499 CAGGCCAACATACAGTGATCAGG + Intergenic
1121034896 14:90693742-90693764 CATTCCCACCAGCAGTTATGAGG - Intronic
1121568738 14:94930531-94930553 CAGCCCCACCTGCACTTGGCTGG + Intergenic
1121631911 14:95427383-95427405 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1122756004 14:103980596-103980618 TAGGCCCGCCCGCAGTTATCCGG - Intronic
1123193251 14:106591716-106591738 CAGACCCGCCCGCACTTATCCGG - Intergenic
1202891077 14_KI270722v1_random:158634-158656 CAGGGCCACCTGCAGTTATCTGG + Intergenic
1124079235 15:26475747-26475769 CAGACCCACCTGCAGGGGTCAGG - Intergenic
1124785534 15:32676043-32676065 AAGGGCCAAATGCAGTTATCTGG - Intronic
1124877334 15:33607370-33607392 CAGGCCCACCTGAAGTGCCCAGG - Intronic
1125785801 15:42316667-42316689 CAGGCCTGCCAGCAGTCATCTGG - Intronic
1125894833 15:43293655-43293677 CACGCCCACCTGCAGTCCCCTGG + Intronic
1126061220 15:44784670-44784692 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1126254018 15:46603559-46603581 CAGAACCACCTGGAGTTATGTGG - Intergenic
1127752157 15:62056644-62056666 CAGGCTTGCCCGCAGTTATCCGG + Intronic
1127877585 15:63123912-63123934 CAGGCTTGCCCGCAGTTATCCGG - Intronic
1128882088 15:71253122-71253144 CAGATCCACCTGCAGTTGCCAGG - Intronic
1129468074 15:75735071-75735093 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1129921127 15:79319972-79319994 CAGGCCCACCCGCAGTTATCCGG - Intronic
1130011487 15:80156016-80156038 CAGGCCTGCCCGCAGTCATCTGG - Intronic
1131053961 15:89364860-89364882 CAGGGGCACCTGCAGCTACCAGG - Intergenic
1132806881 16:1778993-1779015 CAGGCCCAGCTGCAGCCACCCGG + Intronic
1133108153 16:3527610-3527632 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1133785950 16:8973501-8973523 CAGGTTCAAGTGCAGTTATCAGG + Intergenic
1134400475 16:13905204-13905226 CAGGCTTGCCCGCAGTTATCCGG + Intergenic
1136319188 16:29471494-29471516 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1136433759 16:30210838-30210860 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1136584023 16:31172101-31172123 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1138591976 16:58005220-58005242 TAGGCCCGCCCGCAGTTATCTGG - Intronic
1141601238 16:85127633-85127655 CAGGCACACAGGCAGTCATCAGG - Intergenic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1142384297 16:89752955-89752977 CAGACTCGCCCGCAGTTATCCGG + Intronic
1142389994 16:89793081-89793103 CAGGCTCACCCACAGTTATCCGG - Intronic
1143452975 17:7047250-7047272 CAGGCCTCCCCGCAGTCATCCGG - Intergenic
1143464465 17:7126764-7126786 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1143499984 17:7333061-7333083 CAGGCCTCCCCGCAGTCATCCGG - Intergenic
1145732004 17:27197926-27197948 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1146103813 17:30012287-30012309 CAGGCTCGCCCGCAGTTGTCTGG + Intronic
1146356098 17:32135538-32135560 CAGGCTCACCCGCAGTTATCGGG - Intergenic
1147820049 17:43236021-43236043 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147821363 17:43243420-43243442 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147822160 17:43247903-43247925 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147823084 17:43253349-43253371 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147823854 17:43257949-43257971 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147824613 17:43262389-43262411 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147825770 17:43268872-43268894 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147827789 17:43280213-43280235 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147828897 17:43286374-43286396 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147829992 17:43292517-43292539 CAGGCCGGCCCGCAGTCATCCGG + Intergenic
1147834980 17:43323622-43323644 CAGGCCGGCCCGCAGTCATCCGG - Intergenic
1148401131 17:47362580-47362602 CAGGCCTGCCCGCAGTTATCCGG + Intronic
1152154151 17:78622042-78622064 CAGCCCCCCCTGCAGTGACCAGG + Intergenic
1152682487 17:81676253-81676275 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1152740619 17:82016866-82016888 CAGACCCACCGGCACTTACCTGG - Exonic
1152745900 17:82038956-82038978 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1152874332 17:82777763-82777785 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1153163097 18:2230683-2230705 CAGGCCTGCCCACAGTTATCGGG - Intergenic
1155011675 18:21784885-21784907 CAGGCCCGCCCGCAGCCATCCGG + Intronic
1161834079 19:6633209-6633231 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1161870938 19:6869416-6869438 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1161894076 19:7067136-7067158 CAGGCTCGCCTGCAGTTATCTGG - Intergenic
1162141666 19:8589179-8589201 CAGTTCCACCTGCAGTCAGCTGG + Intronic
1162224172 19:9205884-9205906 CAGGCCTGCCTGCAGTTATGCGG + Intergenic
1162638554 19:11988884-11988906 CAGGCCCACCCGCAGCCATCCGG - Intergenic
1163075660 19:14888850-14888872 CAGGCCCGCCGGCAGCCATCCGG - Intergenic
1163456287 19:17407726-17407748 CAGGCTCGCCCGCGGTTATCTGG - Intronic
1163639371 19:18452662-18452684 CAGCCCCACCAGCAGTGATGAGG - Intronic
1163704566 19:18804669-18804691 CAGGCCCCTCTGCAGGTCTCAGG - Intergenic
1163881825 19:19930386-19930408 CAGGCCTGCCTGCAGTTATCCGG - Intronic
1163885191 19:19959170-19959192 CAGGCCTGCCTGCAGTTGTCTGG - Intergenic
1163992120 19:21008419-21008441 CAGGCCCGCCTGCAGCCATCTGG + Intergenic
1164083496 19:21880735-21880757 CAGGCTCACCCGCAGTTATCCGG - Intergenic
1164389087 19:27802312-27802334 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1164955194 19:32377091-32377113 CAGGCCCGCCCGCAGTTATCTGG - Intronic
1164967444 19:32497570-32497592 CAGGCCCTCCCACAGTCATCCGG - Intergenic
1165259002 19:34597269-34597291 CATGCCCACCTGAGGTTACCTGG + Intronic
1165541198 19:36493088-36493110 CAGGCCCGCCCGCAGTTATCTGG - Intergenic
1165915799 19:39258736-39258758 CAGGCCTGCCCGCAGTCATCTGG - Intergenic
1166282021 19:41800487-41800509 CAGGTCCACTCGCAGTTATCCGG + Intronic
1166433977 19:42751653-42751675 CAGGTCCACCCGCAGTTATCTGG - Intronic
1166446832 19:42865429-42865451 CAGGTCCACCTGCAGTTATTTGG - Intronic
1166472157 19:43087724-43087746 CAGGTCCACCCGCAGTTATCTGG - Intronic
1167227775 19:48260090-48260112 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1167519043 19:49941395-49941417 CAGGCTCGCCTGCAGTTATCCGG + Intronic
1167719599 19:51169290-51169312 CAGGCCCACCTGCAGTTATCTGG - Intergenic
1167895528 19:52577792-52577814 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1167919255 19:52769238-52769260 CAGGCCCACCTGCAGTTATCCGG + Intronic
1167927750 19:52835224-52835246 CAGGCCTGCCCGCAGTCATCCGG - Intronic
1167970299 19:53185105-53185127 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1167971399 19:53189692-53189714 CAGGCTCGCCCGCAGTTATCCGG - Intronic
1167990986 19:53360497-53360519 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1168084730 19:54037213-54037235 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1168131503 19:54322865-54322887 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1168215120 19:54919622-54919644 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1168444002 19:56396134-56396156 CAGGCCCACCTGCAGTTATCCGG - Intergenic
1168480920 19:56719008-56719030 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1168603399 19:57738701-57738723 CAGGCCCACCCGCAGTTATCCGG + Intronic
1168680328 19:58310735-58310757 CAGGCTCGCCCACAGTTATCCGG - Intronic
1202666495 1_KI270708v1_random:125472-125494 CAGGCCCACCTGCAGTTATCTGG + Intergenic
926783410 2:16496755-16496777 CAAGCTCAACTTCAGTTATCTGG + Intergenic
927428609 2:23007981-23008003 CAGCCCCACCCACAGCTATCAGG - Intergenic
928020881 2:27703833-27703855 CAGGACCAGCTGCATTTAGCTGG + Intergenic
928365504 2:30697589-30697611 TAGGCCTGCCCGCAGTTATCTGG + Intergenic
929949383 2:46394709-46394731 AAAGCCCACCTGCAAATATCTGG + Intergenic
930115717 2:47716700-47716722 CAGGCCCACCCGCAGTTATCCGG + Intronic
931116662 2:59173255-59173277 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
931848102 2:66225377-66225399 CAGGTTCACCTGCAGTCACCCGG + Intergenic
932342809 2:70977308-70977330 CAGGCCCGCCCACAGTTATCTGG - Intronic
932672982 2:73754256-73754278 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
932777741 2:74538456-74538478 CAGTCCCTCTTGAAGTTATCAGG + Intronic
933928938 2:87128148-87128170 AAGGTCCACCTGCATTCATCTGG - Intergenic
934000272 2:87703934-87703956 AAGGTCCACCTGCATTCATCTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935881853 2:107573242-107573264 CAGGCTCACCCGCAGTTATCTGG + Intergenic
938262234 2:129904171-129904193 CAGGCCCAGCTGCAGACACCTGG - Intergenic
939345732 2:140964321-140964343 CAGGCTCGCCCGCAGTTATCCGG - Intronic
940357113 2:152755374-152755396 CAGGCCCGCCTGCAGTTATCCGG + Intronic
941291053 2:163675603-163675625 CATGCGCACATGCAGATATCTGG - Intronic
941928211 2:170916459-170916481 CAGGCTCGCCCACAGTTATCTGG + Intergenic
941968818 2:171328091-171328113 CACTCCCACCTGCAGTTCTCAGG - Intronic
945779599 2:214153012-214153034 CAGGCTTGCCCGCAGTTATCCGG - Intronic
946416562 2:219543081-219543103 CAGGGCCATCGGAAGTTATCGGG + Intronic
947606599 2:231490024-231490046 CAGGCCCGCCTACAGTTATCCGG - Intergenic
947974354 2:234352209-234352231 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
948813119 2:240495328-240495350 CAGGCCCGCCCACAGTTATCCGG + Intronic
949019348 2:241732548-241732570 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
949046739 2:241875772-241875794 CAGGCTCGCCCACAGTTATCCGG - Intergenic
1168966482 20:1901591-1901613 CAGGAACACCAGCAGTTAACAGG - Intronic
1169175267 20:3506241-3506263 CAGACTCACATGCAGTTATAAGG - Intronic
1170529357 20:17274668-17274690 CAGTCCCAACTGCTGTTACCTGG + Intronic
1170934689 20:20799425-20799447 CAGGCCCAACTGCAGGTACCAGG - Intergenic
1172537724 20:35687220-35687242 CAGGCCTGCCCGCAGTTATCTGG + Intronic
1176007432 20:62874037-62874059 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1176070530 20:63223970-63223992 CAGGCTCACCTGGAGGTTTCAGG - Intergenic
1176076618 20:63251343-63251365 CAGGCCCGCCCGCAGTTATCCGG - Intronic
1176154952 20:63614592-63614614 CAGGCCCGCCCGCAGTTATCCGG + Intronic
1179275980 21:39891975-39891997 CAGGCCTGCCTGCAGTCATCCGG - Intronic
1179595917 21:42443236-42443258 AAGGCTCAGCTGCAGTTAGCTGG - Intronic
1179667508 21:42922936-42922958 CTGGCCTACCTGCCATTATCAGG + Intergenic
1180076218 21:45464422-45464444 CACGGCCACCTGCAGTGGTCAGG + Intronic
1180112003 21:45662977-45662999 CAGGCCTGCCCACAGTTATCTGG + Intronic
1180200978 21:46224001-46224023 CAGACCTGCCCGCAGTTATCCGG + Intronic
1180201209 21:46225523-46225545 CAGGCCCACCCGCAGTTATCCGG + Intronic
1180447431 22:15428057-15428079 CAGATCCCCCTGCAGTTTTCTGG - Intergenic
1180830800 22:18905143-18905165 CAGGCTTGCCTGCAGTTATCCGG - Intergenic
1181598045 22:23930408-23930430 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
1181729894 22:24837486-24837508 CAGGCTCGCCCGCAGTTATCTGG - Intronic
1181837836 22:25625628-25625650 CAGGCTCGCCCACAGTTATCCGG + Intronic
1183627418 22:39013228-39013250 CAGGCCTGCCTGCAGCCATCCGG - Intergenic
1184133430 22:42531597-42531619 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1184351636 22:43947979-43948001 CAGGCTCGCCCACAGTTATCTGG - Intronic
1184805433 22:46792367-46792389 CAGGCCCCCCTGCAGCCACCCGG - Intronic
1185112446 22:48908146-48908168 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
1185244453 22:49765735-49765757 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244475 22:49765806-49765828 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244497 22:49765877-49765899 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244516 22:49765948-49765970 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185244540 22:49766019-49766041 CAGGCCCACCTGCAGTGGGGCGG - Intergenic
1185350490 22:50334157-50334179 CAGGCCCGCCCGCAGCCATCCGG - Intergenic
1185355658 22:50368209-50368231 CAGGCCCGCCCGCAGCCATCTGG - Intronic
1185386533 22:50534314-50534336 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1203280889 22_KI270734v1_random:130414-130436 CAGGCTTGCCTGCAGTTATCCGG - Intergenic
950401300 3:12771101-12771123 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
950689490 3:14644195-14644217 CTGGCCCACCTGCAGCGATGCGG - Intergenic
951599359 3:24356262-24356284 CAGGACCACCTGGAGTTTTGGGG - Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
951704578 3:25530665-25530687 CAGGCCCACCTGGATTTTCCAGG + Intronic
952912480 3:38202989-38203011 CAGGCCTGCCTGCAGTCATCCGG + Intronic
953039718 3:39244996-39245018 CAGGACCACCTTAAGTTATTAGG + Intergenic
953059771 3:39417721-39417743 CAGGCCTGCCTGCAGTTATCCGG + Intergenic
953171844 3:40514114-40514136 CAGGCCCACCCGCAGCCATCCGG + Intronic
953824625 3:46240191-46240213 CAGAGCCACCTGCAGGTCTCTGG - Intronic
953900140 3:46835498-46835520 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
960593401 3:119387019-119387041 CAGGCTCGCCCGCAGTTATCTGG - Intronic
961663529 3:128482866-128482888 CACTCCCGCCTGCAGTTCTCTGG - Intronic
962299394 3:134224522-134224544 CAGGCCCGCCCGCAGCCATCTGG - Intronic
963326967 3:143873978-143874000 CAGGCCTGCCTGCAGTCATCTGG - Intergenic
963405156 3:144854074-144854096 CAGGCCTGCCCGCAGTCATCTGG - Intergenic
964767363 3:160191677-160191699 CAGGCTCACCTGCAGTTCTAGGG - Intergenic
966245554 3:177804321-177804343 GAGTCCCAGCTGCAGTTATGGGG + Intergenic
966815554 3:183887028-183887050 CAGGCTTTCCCGCAGTTATCCGG + Intergenic
968050847 3:195654004-195654026 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
968062543 3:195736989-195737011 CAGGCACACCTGCTTTCATCTGG + Intronic
968104977 3:195994334-195994356 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968108562 3:196022433-196022455 CAGGCCCGCCTGCAGTTATCCGG + Intergenic
968303272 3:197631921-197631943 CAGGCTCGCCTGCAGTTATCCGG - Intergenic
968350909 3:198051172-198051194 CAGGCCCACCCGCAGTTATCCGG + Intergenic
968559136 4:1267928-1267950 TAGGCCCGCCCGCAGTTATCTGG - Intergenic
968655205 4:1775575-1775597 CAGCCCCACCTGCAGATCTGGGG + Intergenic
968729873 4:2264642-2264664 CAGGCCCACCTGCAGCCATCTGG - Intergenic
969457038 4:7306149-7306171 CAAGCCCACATGCAGCTGTCTGG - Intronic
969642423 4:8406884-8406906 CAGGCTTGCCCGCAGTTATCCGG - Intronic
973266810 4:48219399-48219421 CAGGCCTGCCTGCAGTCATCCGG + Intronic
973960924 4:56108952-56108974 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
974240082 4:59235702-59235724 CGGGCTCGCCCGCAGTTATCTGG - Intergenic
974493391 4:62595632-62595654 CAGGCTCGCCCGCAGCTATCTGG + Intergenic
975377817 4:73665921-73665943 CAGGCCCACCCACAGTTATCCGG - Intergenic
976254425 4:83085193-83085215 CAGGCCTGCCCACAGTTATCCGG + Intergenic
977357663 4:95967633-95967655 CAGCCCCACCTTCAATTTTCAGG - Intergenic
977683324 4:99818775-99818797 ATGGGCAACCTGCAGTTATCTGG + Intronic
978308110 4:107354293-107354315 CAGGCCCGCCCGCAGTTATCCGG - Intergenic
978502541 4:109424423-109424445 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
982395117 4:154907791-154907813 CAGGTCCACCCGCAGTCATCCGG - Intergenic
982763403 4:159315906-159315928 CAGGCTCGCCCGCAGTTATCCGG - Intronic
985091099 4:186363404-186363426 CAGGCCCACCTGCAGTTATCTGG + Intergenic
985291360 4:188391340-188391362 CAGGCCTGCCCACAGTTATCTGG - Intergenic
985545310 5:506108-506130 CAGGCACAGGTGCAGTTAACAGG - Intronic
985581399 5:697215-697237 AAGGCTCACCTGCCGTTCTCTGG - Intergenic
985596028 5:788540-788562 AAGGCTCACCTGCCGTTCTCTGG - Intergenic
985674877 5:1225796-1225818 AGGGCCCACCTGCAGTCTTCTGG + Intronic
985848412 5:2371141-2371163 AAGGCCCTCCTGGAGTCATCAGG + Intergenic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
989553886 5:42768822-42768844 AAGGCACACCTGCATATATCTGG - Intronic
990597348 5:57324822-57324844 CAGGCCCACCTCCTGCTTTCTGG - Intergenic
995476451 5:112553096-112553118 CGTGCCCACATGCAGTTATGTGG - Intergenic
997971977 5:138410990-138411012 CAGGCTTGCCCGCAGTTATCCGG - Intronic
1001288243 5:170438898-170438920 CAGGCCCACATGCAGTGTCCAGG - Intronic
1001559087 5:172657772-172657794 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1002550841 5:179990503-179990525 CAGGCCCACCCGCAGTTATCTGG - Intronic
1002635798 5:180608058-180608080 CAGGCCTGCCCGCAGTCATCCGG + Intronic
1004426781 6:15512144-15512166 CAGGGACACCTGCAGTCTTCAGG - Intronic
1005709733 6:28491548-28491570 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1006054594 6:31374152-31374174 CAGGCTTGCCTGCAGCTATCCGG - Intergenic
1006652126 6:35560193-35560215 CAGGCTTGCCCGCAGTTATCCGG - Intergenic
1013470275 6:110457960-110457982 CAGGCCTGCCTGCAGTTATCTGG + Intronic
1014859459 6:126447041-126447063 GAGGCCTACCTGCTGTTATAGGG + Intergenic
1015918975 6:138247864-138247886 CAGGAACACCTGAAGTTAACAGG + Intronic
1019291058 7:250493-250515 CAGGCACACCTCCAGTGATGGGG + Intronic
1019423211 7:961164-961186 CAGGCCTGCCCGCAGTCATCCGG - Intronic
1022705759 7:32800836-32800858 CAGGCCCACCAGCAGTTATCTGG + Intergenic
1023021798 7:36017807-36017829 CAGGCTCGCCCGCAGTTATCCGG - Intergenic
1023723394 7:43117976-43117998 CAGGCTCTCCTGGTGTTATCAGG + Intronic
1023788734 7:43735088-43735110 CAGGCCTGCCCGCAGTCATCCGG - Intergenic
1023827704 7:44020540-44020562 CAGGCCCGCCCACAGTTACCCGG + Intergenic
1024260964 7:47573529-47573551 CAGGGCCACCTGCTGTGTTCTGG - Intronic
1024708189 7:51984768-51984790 CAGGCCCAGCTCCAGTAATGGGG + Intergenic
1026731780 7:72918161-72918183 CAGGCTTGCCCGCAGTTATCTGG - Intronic
1026870115 7:73845841-73845863 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1029408141 7:100390159-100390181 AAAGCCCACCTGCAGCTATGGGG + Intronic
1029562161 7:101309704-101309726 CAGGCTTGCCCGCAGTTATCTGG - Intergenic
1029638370 7:101801605-101801627 CAGGCCCTATTGCTGTTATCTGG - Intergenic
1029699680 7:102238114-102238136 CAGGCTTGCCCGCAGTTATCTGG - Intronic
1029756007 7:102573964-102573986 CAGGCCCGCCCACAGTTACCCGG + Intronic
1029773949 7:102673036-102673058 CAGGCCCGCCCACAGTTACCCGG + Intergenic
1030606626 7:111644959-111644981 CAGGCCCGCCCGCAGTTATCCGG + Intergenic
1033574036 7:142662847-142662869 CAGGCCCGCCCGCGGTTATCCGG + Intergenic
1035156805 7:156920868-156920890 CAGGCCTGCCCGCAGTCATCTGG - Intergenic
1035324374 7:158055477-158055499 CAGGCCCACCCGCAGTTATCCGG + Intronic
1035466080 7:159078786-159078808 CAAGCCCACCTGCATTTTCCTGG - Intronic
1036991955 8:13608119-13608141 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1037057232 8:14457509-14457531 CAGGCTTGCCTGCAGTTATCCGG + Intronic
1037076992 8:14732523-14732545 CAGTCCCACCTGCAGCTGTCAGG + Intronic
1039196361 8:35035901-35035923 CAAGACCACCTGAAGTTTTCAGG + Intergenic
1039555514 8:38472240-38472262 CAGGCCCCCAACCAGTTATCAGG - Intergenic
1039704867 8:39996201-39996223 CAGGCCTGCCTGCAGTCATCTGG + Intronic
1040833437 8:51705166-51705188 CAGGGCCCCCTTCAGTTATGTGG - Intronic
1040953410 8:52957428-52957450 CAGCCCCAGGTGCAGATATCAGG + Intergenic
1041650196 8:60294688-60294710 CAGGCCTGCCCGCAGTCATCTGG + Intergenic
1042849501 8:73202654-73202676 CAGGCCCAACAGCTTTTATCTGG - Intergenic
1043978313 8:86608533-86608555 CAGGCTCACCCGCAGTTATCCGG + Intronic
1046067487 8:109213901-109213923 CAGGCTTGCCTGCAGTTATCTGG + Intergenic
1046413871 8:113884671-113884693 CAGGCCTGCCTGCAGTCATCCGG - Intergenic
1047944308 8:129859390-129859412 CAGGCCCACCTGCAGTTATCCGG - Intronic
1047972553 8:130097669-130097691 CAGGCCCACGGGCAGTTTTCAGG + Intronic
1049458746 8:142710257-142710279 CAGGCTCGCCCGCAGTTATCTGG - Intergenic
1049516241 8:143058617-143058639 CAGACCGGCCCGCAGTTATCCGG - Intronic
1049516430 8:143060302-143060324 CAAGCCCGCCCGCAGTTATCTGG + Intergenic
1049561677 8:143315175-143315197 CAGGCTCGCCCGCAGTTATCCGG + Intronic
1049666223 8:143844322-143844344 CAGGCTCGCCTGCAGTTATCCGG + Intergenic
1049881355 8:145066302-145066324 CAGGCCCACCCGCAGTTATCCGG + Intergenic
1052718723 9:32148923-32148945 CAGGCCCGCCCACAGTTATCCGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055335310 9:75227581-75227603 CAGGCCCACCTCCAGTATTGGGG + Intergenic
1055476249 9:76666340-76666362 CAGGCTTGCCCGCAGTTATCCGG + Intronic
1058294935 9:103294541-103294563 GAGGCCCGCCCGCAGTCATCCGG - Intergenic
1059092449 9:111374346-111374368 CAGGCACACCTGAAGATATTTGG - Intronic
1060972139 9:127744460-127744482 CAGGCCCACCTGCTGTACTTGGG + Intronic
1061039207 9:128129944-128129966 CAGGCTCGCCCGCAGTTATCTGG - Intergenic
1061048768 9:128181851-128181873 CAGGCTTGCCCGCAGTTATCAGG + Intronic
1061066296 9:128279714-128279736 CAGGCCGGCCCGCAGTCATCCGG - Intronic
1061535378 9:131245097-131245119 CAGGCTCGCCCGCAGTTATCCGG + Intergenic
1061682975 9:132252571-132252593 CAGGCCCACCCGCAGTTATCCGG - Intergenic
1061787816 9:133041278-133041300 CAGACCTGCCCGCAGTTATCCGG + Intronic
1061835873 9:133329313-133329335 CAGGCCTGCCCGCAGTTATCTGG - Intergenic
1061993543 9:134173004-134173026 CAGACCCCCGTGCAGTTCTCTGG + Intergenic
1062183924 9:135206317-135206339 CAGGCCTGCCTGCAGTTATTCGG - Intergenic
1062531766 9:137004647-137004669 CAGACCTGCCCGCAGTTATCCGG + Intergenic
1062557204 9:137119056-137119078 CAGACCCGCCCGCAGTTATCCGG + Intergenic
1062645493 9:137546002-137546024 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1062647971 9:137559483-137559505 CAGACCTGCCCGCAGTTATCCGG + Intronic
1203488194 Un_GL000224v1:77849-77871 CATTCCCACCTGCAGTTATCTGG + Intergenic
1203500815 Un_KI270741v1:19745-19767 CATTCCCACCTGCAGTTATCTGG + Intergenic
1185619679 X:1445987-1446009 CAGACCCGCCCGCAGTTATCCGG + Intronic
1187672972 X:21686896-21686918 CAGGCCTGCCCGCAGTCATCCGG + Intergenic
1188212534 X:27442376-27442398 CAGGCCTGCCCACAGTTATCCGG - Intergenic
1189328876 X:40130690-40130712 CAGGCCCAACTGCCTTTTTCAGG + Intronic
1191881670 X:65848874-65848896 CAGCCCCACCTACAGTTCTCTGG + Intergenic
1195314489 X:103664745-103664767 CATGCCCACCTTCAGGCATCCGG - Intergenic
1195803062 X:108734640-108734662 CATGCCCACCTCCAGGTCTCTGG + Exonic
1197077941 X:122375565-122375587 CAGGCTTGCCCGCAGTTATCCGG - Intergenic
1198287532 X:135206815-135206837 TGGGCTCAACTGCAGTTATCCGG + Intergenic
1198998671 X:142606666-142606688 CAGGTCCACCCGAAGTTGTCCGG - Intergenic
1200412665 Y:2876970-2876992 CAGGTTCGCCCGCAGTTATCCGG + Intronic
1200839692 Y:7768399-7768421 CAGTCCCACATACAGTTGTCTGG + Intergenic
1201423539 Y:13825174-13825196 CAGGCCTGCTCGCAGTTATCTGG + Intergenic
1201543787 Y:15138331-15138353 CAGGCCCACCTGCAGCTACCCGG + Intergenic
1201708150 Y:16959439-16959461 CAGGCCCACCCACAGGTATCTGG + Intergenic
1201748382 Y:17405392-17405414 CAGGACCACCCGCAGTTATTTGG + Intergenic