ID: 1167720097

View in Genome Browser
Species Human (GRCh38)
Location 19:51173474-51173496
Sequence CTGTTGTTCTGAAGAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167720097 Original CRISPR CTGTTGTTCTGAAGAGCAGA AGG Intergenic
902117954 1:14137255-14137277 GTGTTGCTTTGAAGACCAGAAGG - Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903367846 1:22815926-22815948 CTGCTGTTCTGAGAGGCAGAAGG + Intronic
905742326 1:40383049-40383071 CTGTTGGTCTTATAAGCAGAGGG + Intronic
905933460 1:41806149-41806171 GTGTTTGTCTGGAGAGCAGAGGG - Intronic
906518522 1:46453598-46453620 CTATTGCACTGCAGAGCAGAGGG - Intergenic
906540525 1:46582298-46582320 CAGTTGTTTATAAGAGCAGATGG + Intronic
906692484 1:47801693-47801715 CTGTTGCTCTGAAGTCCAGAGGG - Intronic
906933741 1:50193969-50193991 CTGTTACTCATAAGAGCAGAAGG + Intronic
908905554 1:69004969-69004991 CAGTTTTTTTGAAGATCAGATGG + Intergenic
910520126 1:88111425-88111447 CAGTTGTTCTGATGAGAAAAGGG - Intergenic
916769149 1:167891325-167891347 CTGTTGTGTTGGAGAGAAGAGGG - Intronic
917729172 1:177857134-177857156 TTATTCTTCTGAAAAGCAGAAGG + Intergenic
917742945 1:177979104-177979126 CTTTTGCTCGGAAGAGCATATGG + Intronic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921592124 1:217016397-217016419 GTGTTGTTCTGAGGAAGAGATGG - Intronic
922574779 1:226654466-226654488 TTCCTGGTCTGAAGAGCAGATGG + Intronic
923558733 1:235022207-235022229 GTGCTGTTCTGAGGAGGAGAAGG - Intergenic
1063648486 10:7909398-7909420 GTGCTGTTCTGAGGGGCAGATGG - Intronic
1064003056 10:11679404-11679426 GTGTTGTTCAGAGGACCAGAGGG + Intergenic
1066249950 10:33623623-33623645 CTGTTAATCTGAAGATCTGAAGG + Intergenic
1070300107 10:75197322-75197344 CTGCTGTTGTGAGGAGCAGAGGG - Intergenic
1071262617 10:83934429-83934451 CTTTCTTTATGAAGAGCAGAGGG - Intergenic
1071774256 10:88767435-88767457 GGGTTGTTTTGAAGATCAGAGGG - Intronic
1072924540 10:99605051-99605073 CTGCTGTTCTGTAGAGCAGGAGG - Intergenic
1073948832 10:108784011-108784033 CAGTTGGTCTGGAGAGCACATGG + Intergenic
1075085805 10:119413727-119413749 GTGTTGTTCTGGAGAGCAACAGG + Intronic
1075306839 10:121375541-121375563 CTTTTGGTCTGGAGAGGAGATGG - Intergenic
1076378231 10:130006781-130006803 CAGTTGGTCTGAAGAGCCCAGGG - Intergenic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1077229874 11:1453958-1453980 CTCTTGAGCTGGAGAGCAGAGGG + Intronic
1077490514 11:2858849-2858871 CTGTTGTAGGGAAGAGGAGACGG + Intergenic
1079332607 11:19546231-19546253 ATGGATTTCTGAAGAGCAGATGG + Intronic
1079747780 11:24155171-24155193 ATGTGGTTCTGTAGACCAGAGGG - Intergenic
1079796725 11:24813156-24813178 CTCTTGTTCAGGAGATCAGATGG - Intronic
1080433724 11:32221159-32221181 ATGTTCTTCTGATGAGCAGTGGG + Intergenic
1081066632 11:38549431-38549453 CCTTTATTCTGATGAGCAGAGGG - Intergenic
1081249121 11:40807593-40807615 CTGCTGTTCAGAGGAGCAAATGG + Intronic
1081763864 11:45595656-45595678 CTGTTTATTTTAAGAGCAGATGG + Intergenic
1082131459 11:48494869-48494891 CTGTGTATTTGAAGAGCAGATGG + Intergenic
1086080070 11:82894805-82894827 CTATTGTTATCAAGAGAAGAAGG + Intronic
1087348804 11:97005052-97005074 TTGCTGTTGTGAAGAGAAGATGG - Intergenic
1088015735 11:105057179-105057201 CTGTTTTTCTGAATAGAGGAAGG - Intronic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1089217578 11:116844102-116844124 CTCTTGTTTTGAAGATCAGAAGG + Intronic
1089302895 11:117509313-117509335 ATGTTATTCAGAAGACCAGAAGG - Intronic
1090533331 11:127613880-127613902 ATGGTGTTCTGAGGAGGAGAAGG + Intergenic
1090574457 11:128086137-128086159 CTGTTGTCCTGGAGAGCACTGGG - Intergenic
1090977012 11:131687459-131687481 GTGATGGTCTGAGGAGCAGAGGG - Intronic
1091280639 11:134379842-134379864 CTGTGGCTCTGAAGAGCTGCAGG + Intronic
1095109853 12:38281426-38281448 TTGTCATTCTAAAGAGCAGATGG - Intergenic
1095412712 12:41941722-41941744 CTCTTGTGTTGAAGAGGAGAGGG - Intergenic
1096222273 12:49838454-49838476 GTTTTGCCCTGAAGAGCAGAAGG + Exonic
1096740068 12:53686714-53686736 CTGTTGGCCTGTAGTGCAGATGG - Intergenic
1097881241 12:64688501-64688523 CTGCTGTTCTCATTAGCAGAGGG + Intronic
1098809136 12:75061859-75061881 CTGTTGTTCTGAGAAGCATCAGG + Intronic
1100338523 12:93655841-93655863 TAGTTGTCCTGAAAAGCAGATGG - Intergenic
1100524236 12:95405061-95405083 CTGTGGCTCTCTAGAGCAGAGGG - Intergenic
1100708677 12:97229809-97229831 CTGGTGTTCTTAAGCACAGAAGG - Intergenic
1100841334 12:98614757-98614779 CTGTTCTTCTGGAAAGCATATGG + Intronic
1103376937 12:120464039-120464061 CTGTTATGCTGATGTGCAGAAGG - Exonic
1103840570 12:123860579-123860601 CTGTTGTTCTGTAGATAAGGAGG + Intronic
1104090501 12:125512928-125512950 CTGATGTCCTGGAGAGGAGAGGG - Intronic
1104184695 12:126419255-126419277 TTGTTGTTCTGAAGACCAAGAGG + Intergenic
1106001781 13:25730368-25730390 CTTTTGTTTTGAAGAACAAAAGG + Intronic
1106475979 13:30098530-30098552 CTGTTATTCTGAACAGCAACTGG - Intergenic
1106704897 13:32269725-32269747 CTGTTATTCTAGTGAGCAGAAGG + Intronic
1108075561 13:46675816-46675838 CCTTTCTTCTGAAGAGCAGTGGG + Intronic
1108359842 13:49659099-49659121 ATGTTGTTATGAGTAGCAGAAGG + Intergenic
1108921319 13:55678182-55678204 GTGCCTTTCTGAAGAGCAGAAGG + Intergenic
1110254905 13:73422732-73422754 GTGTCCTTCTGAAGATCAGAGGG + Intergenic
1111728151 13:92039398-92039420 CTGCTGTTATGATGAGGAGAGGG - Intronic
1112243076 13:97701723-97701745 CTCTTGTTCTGTAGAGCACCTGG + Intergenic
1112972186 13:105273911-105273933 CTATGGGGCTGAAGAGCAGATGG - Intergenic
1115097423 14:29653991-29654013 CTGTTGTTGGGAAGAGTATAAGG + Intronic
1117990584 14:61429118-61429140 CTGTTGGTCTGGAGAATAGAAGG + Intronic
1119707021 14:76789270-76789292 GAGGTGGTCTGAAGAGCAGAAGG + Exonic
1120529302 14:85612689-85612711 CAGGTGTTCTGAAGATGAGAAGG + Intronic
1121182625 14:91941022-91941044 CTGTAGTTGTGAAGAGCAAGAGG + Intronic
1122530060 14:102419112-102419134 CTTGTGTTCTGAAGAGGAAAGGG + Intronic
1123778738 15:23605064-23605086 CTATTGTCTTGAACAGCAGAGGG - Intronic
1126730740 15:51680087-51680109 CTGTTATTATGAAGATCAAATGG - Intergenic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1130297998 15:82660615-82660637 CTGGTGTGCAGGAGAGCAGACGG - Intronic
1131333413 15:91523740-91523762 CTGTTGGTCTGGGAAGCAGATGG + Intergenic
1133208274 16:4247301-4247323 CTGCTGTTCTGAAGAGTGTAGGG + Intergenic
1134384553 16:13759578-13759600 CTGTTTTCCTGAACAGCAGGTGG - Intergenic
1134801052 16:17085132-17085154 TTCTTGTGCTGAAAAGCAGAAGG + Intergenic
1135688811 16:24519932-24519954 CTGTTGCTCTGAAGACAGGAGGG - Intergenic
1135960864 16:26993473-26993495 CCGTTGTTCTGAAAAGCAGGGGG - Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1138487346 16:57354994-57355016 CTGTTATCCTGAAGAGCATCTGG + Intergenic
1140217998 16:73023641-73023663 CTGGTTTTCTGCAAAGCAGAGGG - Intronic
1140636967 16:76926241-76926263 CTTTTCATCTGAAGAGCAGTGGG - Intergenic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1144068248 17:11642990-11643012 ATGTTGGTTTAAAGAGCAGATGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145006569 17:19341921-19341943 CTGGTGGTTTGAAGAGCACAGGG + Intronic
1146184118 17:30713796-30713818 CTGATGTTCAGTACAGCAGACGG + Intergenic
1146515609 17:33486834-33486856 ATGTTGTTCTGAAGACAGGAGGG + Intronic
1147426135 17:40346739-40346761 GTGTTGGAGTGAAGAGCAGACGG + Intronic
1148246449 17:46034082-46034104 CTCTTGGTCAGAAGAGAAGAGGG + Intronic
1148496735 17:48057395-48057417 AGGTTGTTTTGAAGAGCAGGGGG - Exonic
1150584502 17:66505249-66505271 CCGTAGTTCTGATGAGCAAAAGG + Intronic
1151336921 17:73445514-73445536 CTCTGGTTCTGAAGAGCATAGGG + Intronic
1152387889 17:79986010-79986032 CAGCCGTTCTGAAGAGCGGAGGG - Intronic
1160237460 18:77097403-77097425 CTTTTGTTATGCAGAGGAGATGG - Intronic
1160899051 19:1417801-1417823 CTGTTGTCTGGAAGTGCAGAGGG + Intronic
1165218936 19:34298772-34298794 CTTTTGTTTGGGAGAGCAGATGG + Intronic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
1168713100 19:58512850-58512872 CTATTGTGCTGAAGAGGAGAGGG + Intergenic
925197523 2:1938566-1938588 CTGTTGTTCAAATAAGCAGAAGG + Intronic
925702644 2:6654319-6654341 CTGTGGTTTTAAAGAACAGACGG + Intergenic
926234562 2:11029530-11029552 CTCTGGTTCTGCAGAACAGAAGG - Intergenic
926368174 2:12152709-12152731 CTGTTTTTCATAAGACCAGATGG - Intergenic
926447199 2:12957438-12957460 CTTTTGTTCTGTAGGGAAGATGG + Intergenic
927441483 2:23121574-23121596 CTGCAGCACTGAAGAGCAGAGGG - Intergenic
929089126 2:38197390-38197412 CTGGTATTCTGCTGAGCAGAGGG - Intergenic
930467212 2:51770325-51770347 CTGATTTTTTGAAGATCAGATGG + Intergenic
931084121 2:58810024-58810046 CTGTTGTTCAGTGGAGAAGAGGG + Intergenic
931538159 2:63301006-63301028 CCCTTGGTCTGAAGAGCACATGG + Intronic
931929642 2:67116260-67116282 GTGTTGTACTGGAGAGCTGAAGG + Intergenic
933024338 2:77235798-77235820 CTGCTTTTTTGAAGATCAGATGG + Intronic
934487653 2:94731719-94731741 GGGTTGTTCTGAAGATTAGAGGG + Intergenic
936238458 2:110766913-110766935 CTCTTGTCTTGCAGAGCAGATGG - Intronic
936899880 2:117470578-117470600 CCCTTGGTCTGAAGAGCACATGG - Intergenic
938939474 2:136156647-136156669 CTGTTCCTCAGATGAGCAGATGG + Intergenic
939837552 2:147149860-147149882 GTGTTGTTCTGCAGAGCTGGTGG + Intergenic
939935351 2:148285169-148285191 CTATTTGTTTGAAGAGCAGATGG - Intronic
941490371 2:166136495-166136517 CTGCTGTCCTAGAGAGCAGAGGG - Intergenic
941492888 2:166164467-166164489 CTATTGTTAGGAACAGCAGAAGG - Intergenic
942302035 2:174571933-174571955 TTGTTGTTCTGAGGAGGAGGAGG + Exonic
943278168 2:185895957-185895979 CTCTTGTTGAGAAGAGAAGAGGG + Intergenic
943909613 2:193546338-193546360 CTGTTGTTCTGATTCTCAGAGGG - Intergenic
945514918 2:210751341-210751363 CAGATATTCTGCAGAGCAGAAGG + Intergenic
945662044 2:212698496-212698518 GTGTTGTTTTGAAGAACTGAGGG - Intergenic
946515617 2:220407825-220407847 CAGTTTTGCTGAAGATCAGATGG + Intergenic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947150283 2:227108547-227108569 CTCTTGCTCTGAGGAGCAGATGG - Intronic
948131774 2:235606276-235606298 CTGCTGTTGTGGAGAACAGAAGG - Intronic
1169872141 20:10259363-10259385 CTGTAATACTGAGGAGCAGATGG + Intronic
1171245252 20:23605759-23605781 CTGGTGTTCTGAAGAGGAAATGG - Exonic
1172091560 20:32436423-32436445 CTTTAGTTGTGAAGATCAGAAGG + Exonic
1174230266 20:49040558-49040580 CTGATGTGCTGGAGAGCAGATGG + Intergenic
1174745287 20:53056244-53056266 CTGTAGTACTGAAAAGCAGCAGG - Intronic
1175772445 20:61632365-61632387 CTGTTTTGCTGAAAAGCACAGGG - Intronic
1177312802 21:19419340-19419362 CTGTTGTTCTGGAGAGTTCAAGG + Intergenic
1177698952 21:24611895-24611917 CTCTTTTTCTGAAGATCAAAAGG - Intergenic
1177722907 21:24929874-24929896 ATGCTGGTCTGAAGATCAGAAGG - Intergenic
1177861233 21:26457021-26457043 GTGCTGATCTGAAGAGCAGTTGG - Intergenic
1179437682 21:41373576-41373598 CTGTGGGGCTGAAGGGCAGAGGG - Intronic
1179597181 21:42450735-42450757 CTGTGGTGCTGAAGAGCTTAAGG + Intergenic
1181479993 22:23192724-23192746 CTGTTGGTGGGAAAAGCAGATGG - Intronic
1184740253 22:46423994-46424016 TTGTTGTTTTGGAGAGCATAGGG + Intronic
951008521 3:17648188-17648210 CTGCTGTTTTGAAGATCAGATGG - Intronic
954236036 3:49257979-49258001 TTGTATTTCTGAAGAGCAGTGGG + Exonic
954856560 3:53648885-53648907 ATGGTGTTCTGAGGAGCAAAGGG + Intronic
955156996 3:56426675-56426697 CTGCTGTTCTGAGGAGAAGGTGG + Intronic
955918086 3:63926475-63926497 CTGGTGTTTTGAAGAACAGCAGG + Intronic
956417692 3:69051165-69051187 GAGTTGTTCTGAAGATGAGAAGG + Intronic
956464563 3:69506222-69506244 GTGTTGTTCTGAAGAGGAAGTGG - Intronic
959010037 3:101064667-101064689 AATTTGTTCTGAAGAACAGATGG + Intergenic
959998674 3:112707053-112707075 CAGTTGTTTTAAAGATCAGATGG + Intergenic
962380810 3:134897041-134897063 GGGTTTTTCTGAAAAGCAGAGGG + Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
962944904 3:140158886-140158908 CTATTTTGCTGAAGATCAGATGG - Intronic
962984892 3:140526793-140526815 CTATTTTGCTGAAGATCAGATGG - Intronic
963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG + Intergenic
963849196 3:150192920-150192942 TTGTTGTTTTGAAGGGAAGAGGG + Intergenic
964595003 3:158416015-158416037 TTTTTATTCTGAAGATCAGAGGG + Intronic
965136315 3:164774562-164774584 CTATTATTCTGTAGAGCAGATGG - Intergenic
968268674 3:197382614-197382636 CTGTTGGGCAGCAGAGCAGAGGG + Intergenic
974492007 4:62577002-62577024 ATCTTGTTCTGAATATCAGAAGG + Intergenic
976663503 4:87565226-87565248 CTGTAGTTCTAAAAAGCAAAGGG + Intergenic
979345651 4:119583898-119583920 CTTTTGTTTTCAAAAGCAGATGG + Intronic
979545308 4:121933249-121933271 CTTTTGTTCTGAAGGGCTGCCGG - Intronic
980251336 4:130319648-130319670 CTGTGGTTATGAAGAAGAGAGGG + Intergenic
980642272 4:135596229-135596251 CTCTTGGTCTGGAGAGCACATGG + Intergenic
980870332 4:138603990-138604012 CTATTCTTCTGAGGAGGAGAGGG - Intergenic
981309010 4:143277838-143277860 GTGTTTTTCTCAAGAGTAGAGGG - Intergenic
982689551 4:158532480-158532502 CTGTTGGTCAGAAGGGGAGAAGG - Intronic
983618720 4:169736670-169736692 GTTCTGTTCTGAAAAGCAGACGG + Intronic
983822266 4:172210529-172210551 CTGTTTTTCTGATGATTAGATGG + Intronic
984141567 4:176010541-176010563 CTGCTGTAGTGAAGAGGAGAGGG + Intergenic
984537798 4:180998725-180998747 ATGTACTTCTGAAGAGCATAAGG - Intergenic
984563909 4:181304701-181304723 CTCTTGTTTTGATGAGCAGTAGG + Intergenic
986511487 5:8511362-8511384 CTGATTTGCTGAAGATCAGATGG + Intergenic
986593732 5:9398637-9398659 CTTTTCATCTGAAGGGCAGAAGG - Intronic
987384763 5:17318692-17318714 CTCTTGATCTTCAGAGCAGAAGG + Intergenic
989373599 5:40735649-40735671 TTGTTGATCTGGAGAGCAAAAGG + Intronic
989739351 5:44751907-44751929 CTATTGTTCTGAAAATCAAATGG + Intergenic
990151691 5:52825114-52825136 CTGTAGTTCCCAGGAGCAGAGGG - Intronic
990376983 5:55180550-55180572 ATGTTGCTGTGAAGACCAGATGG + Intergenic
990596187 5:57314612-57314634 ATGTTTTTCTGAAGTGGAGAGGG + Intergenic
992169922 5:74091526-74091548 CTGGTGTTCTGTAGCACAGATGG - Intergenic
992379666 5:76224791-76224813 CTGTGCTTGTGAAGAACAGATGG - Intronic
993204372 5:84861414-84861436 CTGTGTTTCTGGATAGCAGAAGG - Intergenic
993321360 5:86471701-86471723 TTGTTGTTCTGAAGAAGAGGTGG + Intergenic
994018128 5:94992380-94992402 CACTTGTTCTAAAGAGTAGATGG - Intronic
995366773 5:111370637-111370659 TTGTTGACCTGAAGAGAAGATGG + Intronic
996374147 5:122786157-122786179 CTGTTGTGCTAAACATCAGAGGG - Intronic
997602373 5:135149493-135149515 GGGTTGTTATGAAGAGCAGAAGG + Intronic
1000195709 5:158955452-158955474 TTGTTGATATGAAAAGCAGAAGG - Intronic
1000407556 5:160904678-160904700 ATAATGTTCTGAAGAGCAGTTGG + Intergenic
1001874542 5:175188122-175188144 GTGTTGTTCTCAAGAGAAGGAGG + Intergenic
1002198004 5:177511628-177511650 CAGTAATTCTGAAGAGCACAGGG + Exonic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002837450 6:876895-876917 CTGAAGTTCTGCAGAGCAGACGG + Intergenic
1004963405 6:20819502-20819524 CTGTTTTTCTGATGATCAAATGG + Intronic
1005060498 6:21772751-21772773 CAGTTTTCCTGAAGATCAGAAGG - Intergenic
1006277854 6:33020517-33020539 CTGTTGTTCTCCAAAGCAGTTGG - Intergenic
1007667313 6:43522743-43522765 CTGTTTTTGTGCAGAGCACATGG + Exonic
1007807034 6:44458129-44458151 TTGTTGTTCTAAAGGGCAGATGG + Intergenic
1012801172 6:103830778-103830800 GTTTTGTTTTGTAGAGCAGAGGG + Intergenic
1015190479 6:130466709-130466731 GTGCTCTTCTGAAAAGCAGAAGG + Intergenic
1015696617 6:135987525-135987547 GTGTTATTCTGAAGGGAAGAAGG - Intronic
1016777839 6:147924471-147924493 CTTATGTTCTGAAAAGCACATGG - Intergenic
1018555784 6:165049512-165049534 CTCTTGGTCTGAAGAGCACATGG + Intergenic
1019039701 6:169093698-169093720 GTGTTGTTGTGAAGGGCAGATGG - Intergenic
1021375752 7:19904911-19904933 CTGTTAGTCTGATGGGCAGAAGG + Intergenic
1022880997 7:34587256-34587278 CTGTTGATCTGAAGGGAACATGG - Intergenic
1023764318 7:43496631-43496653 CTGTGGTCCCCAAGAGCAGATGG + Intronic
1024468708 7:49742912-49742934 CTTTTGTTCTGCAGAGAAGGTGG - Intergenic
1028251893 7:88546982-88547004 CCGTTGGTCTGGAGAGCACATGG - Intergenic
1028591499 7:92500788-92500810 TTGTTCTTCAGAAGATCAGATGG - Intronic
1030374624 7:108740897-108740919 CTGCTTTTCTGAAGATCAGATGG + Intergenic
1030470538 7:109957663-109957685 CTGGTGGCCAGAAGAGCAGACGG - Intergenic
1031383540 7:121117841-121117863 TCTTTCTTCTGAAGAGCAGAAGG - Intronic
1031571785 7:123368414-123368436 CTGTTATTTTGAAGAACAGAGGG + Intergenic
1033565782 7:142576561-142576583 CTCCTGTTCTGATGATCAGAAGG - Intergenic
1034286699 7:149888702-149888724 CAATGGTTTTGAAGAGCAGAAGG - Intergenic
1035477521 7:159153691-159153713 CTGTAGCTCTGGAGAACAGAAGG + Intergenic
1035626937 8:1077394-1077416 CCGTGGTTCTCAGGAGCAGAGGG + Intergenic
1035698611 8:1620944-1620966 TTGTTTGTCTGGAGAGCAGAGGG - Intronic
1036590922 8:10167301-10167323 CTGTTGTGCTGAAAATCACATGG + Intronic
1036926029 8:12906900-12906922 CAGTTTTTCAGAAGAGCAGGTGG + Intergenic
1037793380 8:21968163-21968185 CTGTTGTTCAGAATACCACATGG - Intronic
1038672984 8:29597217-29597239 CTGTTCTTCTGAAGTGCTCATGG + Intergenic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1039002276 8:32995035-32995057 CTGTTGTACTGCAGAGAAGCTGG + Intergenic
1039260708 8:35768208-35768230 TAGTTTTTCTGAAGAGCGGATGG + Intronic
1039474662 8:37833368-37833390 CAGTGGGTCTGAATAGCAGAGGG - Intronic
1039730442 8:40269927-40269949 CTGCATTTCTGAAGACCAGATGG - Intergenic
1041271273 8:56111588-56111610 CTGTTCTTCAGAAAAGCAAAAGG - Intergenic
1041960254 8:63606719-63606741 CTGCTGCTGAGAAGAGCAGATGG - Intergenic
1042168478 8:65970176-65970198 GTGTTGTTTTGAAGAGAATATGG + Intergenic
1042491722 8:69407171-69407193 CTGATCTTCTGTAGAGCAAAGGG + Intergenic
1043244486 8:77980063-77980085 CTCTTATTCTGAATAGCTGAAGG + Intergenic
1045835336 8:106513952-106513974 CTTTTCTTCTCAAAAGCAGAAGG + Intronic
1046030973 8:108783951-108783973 CTATCCTTCTGAAGAGCTGAAGG - Exonic
1046849534 8:118956492-118956514 CTGTTGTTCTGATCAGCTCAAGG + Intergenic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1047558981 8:125965970-125965992 CTGATCATCTGAAGGGCAGATGG - Intergenic
1047768842 8:128014031-128014053 CTGTTGTTCTGGTGAGCAGTGGG + Intergenic
1050151074 9:2620479-2620501 TTGGTGATCTGAAGAGCAGCGGG - Intergenic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1052215804 9:25964463-25964485 CTCTTGGTCTGGAGAGCACATGG - Intergenic
1053117464 9:35518132-35518154 CTGTTGTTCTGATGACCAAGTGG + Intronic
1053351171 9:37414346-37414368 CTGCTCTTCTGGGGAGCAGAGGG - Intergenic
1053670148 9:40352695-40352717 GGGTTGTTCTGAAGATTAGAGGG - Intergenic
1053919937 9:42978952-42978974 GGGTTGTTCTGAAGATTAGAGGG - Intergenic
1054381270 9:64492683-64492705 GGGTTGTTCTGAAGATTAGAGGG - Intergenic
1054514466 9:66023602-66023624 GGGTTGTTCTGAAGATTAGAGGG + Intergenic
1055998182 9:82184738-82184760 CTGTTGTTTTGAAGATGAGAGGG + Intergenic
1057397892 9:94696317-94696339 CTTATGTTCTGGTGAGCAGAGGG - Intergenic
1058482416 9:105409902-105409924 CTATTCTTCTGAAGTGCACATGG + Intronic
1059935958 9:119310900-119310922 CTGTTGCTCTGATGAGCATCTGG + Intronic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1061388156 9:130302648-130302670 CTGTTGTCCTGAGGAGCTGGAGG - Intronic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1062666096 9:137673434-137673456 ATGTTGTTCTGAAGAGGAGATGG + Intronic
1194154339 X:90368192-90368214 CTGCTGTTGTGAAGAGCAGTTGG + Intergenic
1195246956 X:103003555-103003577 CAGTTCTACTGAAGAGCAGAAGG - Intergenic
1196521356 X:116676416-116676438 GTGTTGTGTTGGAGAGCAGAGGG + Intergenic
1197166706 X:123385282-123385304 CAGTTTTGCTGAAGATCAGATGG + Intronic
1197356190 X:125439423-125439445 CTCTTGGTCTGGAGAGCATATGG - Intergenic
1197525926 X:127562709-127562731 CAGGTTTGCTGAAGAGCAGATGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1200500697 Y:3945089-3945111 CTGCTGTTGTGAAGAGCAGTTGG + Intergenic