ID: 1167721670

View in Genome Browser
Species Human (GRCh38)
Location 19:51184132-51184154
Sequence AGGACTGAGCAGAGGGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167721670_1167721677 3 Left 1167721670 19:51184132-51184154 CCCGCATCCCTCTGCTCAGTCCT No data
Right 1167721677 19:51184158-51184180 GAGACTGAACCCTCAACCTAGGG No data
1167721670_1167721678 4 Left 1167721670 19:51184132-51184154 CCCGCATCCCTCTGCTCAGTCCT No data
Right 1167721678 19:51184159-51184181 AGACTGAACCCTCAACCTAGGGG No data
1167721670_1167721676 2 Left 1167721670 19:51184132-51184154 CCCGCATCCCTCTGCTCAGTCCT No data
Right 1167721676 19:51184157-51184179 TGAGACTGAACCCTCAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167721670 Original CRISPR AGGACTGAGCAGAGGGATGC GGG (reversed) Intergenic
No off target data available for this crispr