ID: 1167721965

View in Genome Browser
Species Human (GRCh38)
Location 19:51185485-51185507
Sequence GGTCAGGTTTCCCGGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167721965_1167721975 7 Left 1167721965 19:51185485-51185507 CCGGCCGCCCGGGAAACCTGACC No data
Right 1167721975 19:51185515-51185537 TGTCCTGGGCCTGTGAGCAGGGG No data
1167721965_1167721971 -7 Left 1167721965 19:51185485-51185507 CCGGCCGCCCGGGAAACCTGACC No data
Right 1167721971 19:51185501-51185523 CCTGACCTGCTCTGTGTCCTGGG No data
1167721965_1167721974 6 Left 1167721965 19:51185485-51185507 CCGGCCGCCCGGGAAACCTGACC No data
Right 1167721974 19:51185514-51185536 GTGTCCTGGGCCTGTGAGCAGGG No data
1167721965_1167721978 27 Left 1167721965 19:51185485-51185507 CCGGCCGCCCGGGAAACCTGACC No data
Right 1167721978 19:51185535-51185557 GGGATACCCCTACCATCTCCTGG No data
1167721965_1167721973 5 Left 1167721965 19:51185485-51185507 CCGGCCGCCCGGGAAACCTGACC No data
Right 1167721973 19:51185513-51185535 TGTGTCCTGGGCCTGTGAGCAGG No data
1167721965_1167721969 -8 Left 1167721965 19:51185485-51185507 CCGGCCGCCCGGGAAACCTGACC No data
Right 1167721969 19:51185500-51185522 ACCTGACCTGCTCTGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167721965 Original CRISPR GGTCAGGTTTCCCGGGCGGC CGG (reversed) Intergenic