ID: 1167725171

View in Genome Browser
Species Human (GRCh38)
Location 19:51207046-51207068
Sequence CTCAGAAGATACCTTGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167725166_1167725171 -9 Left 1167725166 19:51207032-51207054 CCCACCACCCTACTCTCAGAAGA No data
Right 1167725171 19:51207046-51207068 CTCAGAAGATACCTTGATTCTGG No data
1167725165_1167725171 -6 Left 1167725165 19:51207029-51207051 CCTCCCACCACCCTACTCTCAGA No data
Right 1167725171 19:51207046-51207068 CTCAGAAGATACCTTGATTCTGG No data
1167725167_1167725171 -10 Left 1167725167 19:51207033-51207055 CCACCACCCTACTCTCAGAAGAT No data
Right 1167725171 19:51207046-51207068 CTCAGAAGATACCTTGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167725171 Original CRISPR CTCAGAAGATACCTTGATTC TGG Intergenic
No off target data available for this crispr