ID: 1167725754

View in Genome Browser
Species Human (GRCh38)
Location 19:51211758-51211780
Sequence ACGGGGATGCAGGATCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167725754_1167725767 23 Left 1167725754 19:51211758-51211780 CCTTCCTGATCCTGCATCCCCGT No data
Right 1167725767 19:51211804-51211826 GGCCCAGCATCTTCATCCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 119
1167725754_1167725770 30 Left 1167725754 19:51211758-51211780 CCTTCCTGATCCTGCATCCCCGT No data
Right 1167725770 19:51211811-51211833 CATCTTCATCCCGAGGACCCTGG 0: 1
1: 0
2: 0
3: 16
4: 135
1167725754_1167725761 2 Left 1167725754 19:51211758-51211780 CCTTCCTGATCCTGCATCCCCGT No data
Right 1167725761 19:51211783-51211805 CCTCACCAGCCCTGACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167725754 Original CRISPR ACGGGGATGCAGGATCAGGA AGG (reversed) Intergenic
No off target data available for this crispr