ID: 1167725903

View in Genome Browser
Species Human (GRCh38)
Location 19:51212358-51212380
Sequence AGGATAGAAACTCCCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167725895_1167725903 14 Left 1167725895 19:51212321-51212343 CCTAAAGATTGGTGTCTCCCTAG No data
Right 1167725903 19:51212358-51212380 AGGATAGAAACTCCCTCCTTGGG No data
1167725901_1167725903 -4 Left 1167725901 19:51212339-51212361 CCTAGGAGAAGGCACAGGTAGGA No data
Right 1167725903 19:51212358-51212380 AGGATAGAAACTCCCTCCTTGGG No data
1167725899_1167725903 -3 Left 1167725899 19:51212338-51212360 CCCTAGGAGAAGGCACAGGTAGG No data
Right 1167725903 19:51212358-51212380 AGGATAGAAACTCCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167725903 Original CRISPR AGGATAGAAACTCCCTCCTT GGG Intergenic
No off target data available for this crispr