ID: 1167731110

View in Genome Browser
Species Human (GRCh38)
Location 19:51256541-51256563
Sequence AGGGGCACAAAGTTTCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 1, 2: 17, 3: 122, 4: 626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167731106_1167731110 14 Left 1167731106 19:51256504-51256526 CCAGGGCTGAGGGCTAAGGGAAA 0: 1
1: 1
2: 22
3: 31
4: 307
Right 1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG 0: 1
1: 1
2: 17
3: 122
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167731110 Original CRISPR AGGGGCACAAAGTTTCAGCT AGG Intronic
900185244 1:1330382-1330404 GGGGGCACTCAGCTTCAGCTAGG - Intergenic
900415672 1:2533432-2533454 ATGGGGACAGAGGTTCAGCTTGG - Intergenic
900456792 1:2778873-2778895 ACGGGGACAGAGTTTCAGTTTGG - Intronic
901136311 1:6999036-6999058 GTGGGCACAGAGTTTCAGTTTGG - Intronic
901150474 1:7097880-7097902 ATGGGTACAGCGTTTCAGCTGGG + Intronic
901162365 1:7188432-7188454 ATGGGTACAGAGTTTCAGTTTGG - Intronic
901216178 1:7556614-7556636 TGGGGCACAAGGTTTGAGATGGG - Intronic
901450623 1:9334626-9334648 ATGGGCACAGAGTTTCCGTTGGG - Intronic
903258470 1:22118316-22118338 TGGGGCTCTAAGTTTCAGGTCGG - Exonic
903438300 1:23368853-23368875 CGGGGCTCAAAGTTCCAGCGCGG - Intronic
903776189 1:25795419-25795441 ATGGGTACAAAGTTTCTTCTGGG - Intergenic
904112536 1:28137599-28137621 ATGGGTACAAAGTTTCAATTTGG - Intergenic
904323764 1:29713753-29713775 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
904451312 1:30614408-30614430 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
904478697 1:30780882-30780904 ATGGGCACAGAGTTTGAGTTTGG + Intergenic
904631356 1:31844916-31844938 ATGGGTACACAGTTTCAGTTGGG - Intergenic
904991236 1:34594560-34594582 AAGGGTACAAAGTTTCATTTAGG - Intergenic
904994512 1:34620872-34620894 AGGGGTACAAAGTTAGAACTTGG + Intergenic
905072315 1:35237554-35237576 AGAGGCAAAAGGTTTCAACTTGG + Intergenic
905323758 1:37135773-37135795 AAGGACACAAAATTACAGCTAGG - Intergenic
906652577 1:47523348-47523370 AAGGGTACAAAGTTTCGGTTGGG - Intergenic
907177873 1:52542217-52542239 ACGGGTACAGAGTTTCAGCTTGG + Intronic
907538365 1:55186791-55186813 ATGGGTACAGAGTTTCAGCTGGG + Intronic
907653297 1:56317225-56317247 ATGGATACAAAGTTTCAGTTTGG + Intergenic
908648276 1:66303548-66303570 AAGGGTACAAAGTTTCTGTTAGG - Intronic
908716360 1:67074142-67074164 AGTGGCACAAATTTTCACATTGG + Intergenic
908785716 1:67732817-67732839 AGGGGCAGCAAGTTTCCGCAGGG + Intronic
909198456 1:72657650-72657672 AAGGGCACATAGTTTCAGTTAGG - Intergenic
909242604 1:73234293-73234315 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
910103766 1:83607771-83607793 AAGGGTACAAAATTTCAGTTAGG + Intergenic
910316439 1:85889867-85889889 ATGGGTACAGAGTTTCAGTTTGG - Intronic
911130625 1:94383804-94383826 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
911345193 1:96688449-96688471 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
911659095 1:100480109-100480131 ATGGGTACAAAGTTTCTGTTTGG - Intronic
911786678 1:101959004-101959026 AAGGGTACAAAGTTTTAGTTAGG - Intronic
912178548 1:107190186-107190208 ATGGGCACAGAGTTTCAGTTTGG + Intronic
912190757 1:107337485-107337507 ATGAGCACAAAGTTTCAGTTAGG + Intronic
912305912 1:108566879-108566901 TAGGGCACAAAGTTTCAATTAGG + Intronic
912548651 1:110469488-110469510 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
912754863 1:112315789-112315811 AATGGTACAAAGTTTCAGTTAGG + Intergenic
914723498 1:150308501-150308523 ATGGGTACAGAGTTTCAGTTTGG + Exonic
914973916 1:152340014-152340036 ATGGATACAGAGTTTCAGCTTGG + Intergenic
915707641 1:157861729-157861751 ATGGGCACAGAGTTTCAGTTTGG + Intronic
916204731 1:162305255-162305277 ACGGGCACAGAGTTTCTGTTTGG - Intronic
916617729 1:166459942-166459964 ATGAGTACAAAATTTCAGCTAGG - Intergenic
917908533 1:179614987-179615009 AAGGACACAAACTTTCAGTTAGG - Intronic
917985796 1:180317374-180317396 ATGGGTACAGAGTTTCAGTTTGG + Intronic
918452583 1:184673804-184673826 AAAGGTACAAAGTTTCAGTTAGG - Intergenic
918509018 1:185289869-185289891 AAGGACACAAAATTTCAGATAGG + Intronic
918515425 1:185358227-185358249 AGGGGTACAAAGTTAGAGTTAGG - Intergenic
918710951 1:187729316-187729338 ATGGGGAAAAAGTTTCAGTTTGG + Intergenic
920121549 1:203662426-203662448 ATGGGTACAGAGTTTCAGTTTGG - Intronic
920175083 1:204095788-204095810 ATGGGAACAGAGTTTCAGTTTGG - Intronic
920410066 1:205752211-205752233 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
920808257 1:209255493-209255515 ATGGGTACAGAGTTTCAGCTTGG - Intergenic
920858069 1:209679618-209679640 AGGGGTACAAAGTTTCAATTAGG - Intergenic
922295000 1:224242172-224242194 ATGGGGACAGAGTTTCAGTTTGG + Intronic
922337323 1:224628400-224628422 ATGGGCACAGAGTTTCTGTTTGG - Intronic
922364190 1:224848729-224848751 AAAGGTACAAAGTTTCAGTTAGG + Intergenic
922562079 1:226576693-226576715 ATGGGCACAGAGTTTCCGTTTGG - Intronic
922779734 1:228241922-228241944 AAGTGTACAAAGTTTCAGTTTGG + Intronic
922985412 1:229862532-229862554 AGGAGTACAGAGTTTCAGTTTGG - Intergenic
923090141 1:230734415-230734437 ATGGGCACAGAATTTCAGTTGGG + Intergenic
923651890 1:235881889-235881911 ATGGGTACAAAATTTCAGCTGGG + Intronic
924545493 1:245022864-245022886 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1062949018 10:1482542-1482564 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1063521568 10:6746193-6746215 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1063582626 10:7322461-7322483 AGGGCCAGTCAGTTTCAGCTGGG - Intronic
1063618729 10:7625379-7625401 ATGGGTACAAAGTTTCAGTTTGG + Intronic
1064091884 10:12392757-12392779 AAGGATACAAAATTTCAGCTGGG - Intronic
1064476234 10:15691731-15691753 AAAGGTACAAAGTTTCAGTTGGG + Intronic
1064634685 10:17351913-17351935 AAGGGTACAAAGTTTCAGTTGGG + Intronic
1064667017 10:17664384-17664406 ATGGGCACAGGGTTTCAGTTTGG - Intronic
1064735675 10:18379613-18379635 ATGGGCACAGAGTTTCAGCCAGG - Intronic
1065884449 10:30064624-30064646 ATGGGTACAAAGTTTCATTTAGG - Intronic
1066252999 10:33652336-33652358 ATGAGTACAGAGTTTCAGCTTGG - Intergenic
1066396027 10:35022661-35022683 AAGGGGACAAAGTTTCAGTTAGG + Intronic
1066456826 10:35579536-35579558 ATGGGTACAAAGTTTCACTTAGG + Intergenic
1067546770 10:47197456-47197478 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1067856867 10:49801929-49801951 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1067935300 10:50606339-50606361 ATGGGCATAGAGTTTCAGCTTGG + Intronic
1068806998 10:61207775-61207797 GAGGGTACAAAGTTTCAGTTAGG + Intergenic
1069147521 10:64914044-64914066 AAGGGTACAATGTTTCAGTTAGG - Intergenic
1069266792 10:66468494-66468516 AGGTGTACAAAGTTTCATTTAGG + Intronic
1069444389 10:68459626-68459648 AAGGGCACAAAGCTTCAGTTTGG + Intronic
1069495855 10:68902583-68902605 ATGGGCACAGAGTTTCAGTCTGG - Intronic
1070073512 10:73112745-73112767 AAGTGTACAAAGTTTCAGTTAGG - Intronic
1070495738 10:77020317-77020339 AGGTGAACAAAGGTTCACCTGGG - Intronic
1070574061 10:77664100-77664122 ATGGGCACATAGTTTCAGTTTGG - Intergenic
1071057786 10:81530964-81530986 AGGGGCACAAAATGACAGATAGG - Intergenic
1071171033 10:82864122-82864144 GGGGGCACAGAGTTTCTGATTGG + Intronic
1071329217 10:84543713-84543735 AGGGGCCCAAAGTTGAAGATAGG + Intergenic
1071483832 10:86084902-86084924 ATGGGTACAAAGTTGCAGTTTGG + Intronic
1071529761 10:86380171-86380193 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1071844932 10:89512177-89512199 ATGGGCACAGAGTTTCAGTATGG + Intronic
1072136501 10:92551730-92551752 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1072566514 10:96621109-96621131 AGGGGCACTAAGCATCATCTTGG - Intronic
1072802760 10:98404885-98404907 AGGGCCACAAAGTATGACCTGGG - Intronic
1073564984 10:104527306-104527328 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1073707130 10:105997595-105997617 AAGGACACAAAGTTTCAGTTGGG - Intergenic
1074285400 10:112093032-112093054 AGGGGCACATAGTATCATATGGG + Intergenic
1074376483 10:112945061-112945083 AGGTGAAAAAAGTTTCATCTAGG - Intergenic
1074478935 10:113800700-113800722 AGGAGTACAAAGCTTCAGTTAGG - Intergenic
1075327363 10:121544694-121544716 ATGGGTACAAAGTTTCTGTTTGG + Intronic
1075535352 10:123266947-123266969 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1076064025 10:127434537-127434559 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1076121855 10:127942742-127942764 AGAGGGACAGAGTTTCAGTTTGG + Intronic
1076378833 10:130011330-130011352 AGGGGTCCATGGTTTCAGCTGGG + Intergenic
1077182078 11:1221254-1221276 ATGGGGACAGGGTTTCAGCTTGG - Intergenic
1078612751 11:12835866-12835888 ACGGGTACAAAGTTTCAGTTAGG + Intronic
1079341655 11:19616669-19616691 AGGAGCACAATGCTTCTGCTTGG + Intronic
1079346936 11:19661058-19661080 AGGGGTAGAGAGTTTCAGTTTGG - Intronic
1079982717 11:27168249-27168271 ATGGGTACAAAGTTTAAGTTAGG - Intergenic
1080220130 11:29893338-29893360 AAGGACACAAAATTTCATCTAGG + Intergenic
1080510427 11:32964287-32964309 AGGGGGAAAAAGTTTCACTTAGG - Intronic
1080719470 11:34835360-34835382 AGGGGCACAGACTTTCAGTTTGG + Intergenic
1080924315 11:36740150-36740172 AGGGGCAGAAAGTGACAGCAGGG + Intergenic
1081052545 11:38362536-38362558 ATGGGAACAATGTTTCAGTTTGG - Intergenic
1081187096 11:40057061-40057083 AGGGATACAAAGTTTCAGTTAGG + Intergenic
1081624197 11:44637664-44637686 ATGGGTACAAAGTTACAGTTAGG + Intergenic
1082723076 11:56702788-56702810 AAGGGTACAAAGTTTCATGTAGG + Intergenic
1082892003 11:58149583-58149605 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1083327971 11:61883170-61883192 ATGGGGACAGAGTTTCAGTTGGG - Intronic
1083373329 11:62199226-62199248 AGGGGTACAGAGTTTCTGTTTGG + Intergenic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1083837245 11:65278979-65279001 AGAGTAACAAAGCTTCAGCTAGG + Intronic
1084281539 11:68098527-68098549 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1084582246 11:70031450-70031472 AAGGATACAAAGTTTCAGATAGG - Intergenic
1084625323 11:70301994-70302016 ATGGGCACAGCCTTTCAGCTGGG + Intronic
1084677447 11:70644287-70644309 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1084724639 11:70933391-70933413 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1084763010 11:71285942-71285964 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1085753541 11:79184745-79184767 ATGGGCATAGAGTTTCAGTTTGG + Intronic
1085802664 11:79604788-79604810 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1086463873 11:87034096-87034118 AGGGGCAACAATTTTCATCTTGG + Intergenic
1087220680 11:95543324-95543346 AGTGGCACAAAGTTACATGTGGG - Intergenic
1087709331 11:101530972-101530994 AAGGGTACAAACTTTCAGTTTGG + Intronic
1088187368 11:107186567-107186589 AAGGGCACAAAATTTCAGTTAGG - Intergenic
1088430275 11:109751104-109751126 ATGGGTACAAAATTTCAGTTTGG + Intergenic
1088497851 11:110449957-110449979 AAGGCTACAAAGTTTCAGTTAGG - Intronic
1088791995 11:113234407-113234429 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1088990206 11:114947172-114947194 AGAGGCTCAAAAATTCAGCTTGG + Intergenic
1089008849 11:115115871-115115893 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1090286305 11:125502519-125502541 AGCTTTACAAAGTTTCAGCTGGG + Intergenic
1090492187 11:127174487-127174509 ATGGGCACAGGGTTTCAGTTTGG - Intergenic
1090718882 11:129454729-129454751 AAGGGTACAAAATTTCAGTTAGG - Intergenic
1090884512 11:130864037-130864059 AAGGACACAAAATTTCAGTTAGG + Intergenic
1091164550 11:133463274-133463296 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1091568980 12:1668033-1668055 ATGGGGACAGAGTTTCAGTTGGG + Intergenic
1091939287 12:4461927-4461949 ATGGGTATAAAGTTACAGCTAGG - Intergenic
1091983819 12:4890771-4890793 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1092214300 12:6669980-6670002 AGGGGAACAAGATTTCAGTTAGG - Intronic
1092749018 12:11701248-11701270 CTGGGGACAGAGTTTCAGCTGGG - Intronic
1093156274 12:15689742-15689764 ATGGGTACACAGTTTCAGTTAGG - Intronic
1093298212 12:17417638-17417660 ACGGGTACAAAGTTGCAGTTAGG - Intergenic
1093466128 12:19451512-19451534 AAGGGAACACAGTTTCAGCCTGG - Intronic
1094046437 12:26172645-26172667 AGTGGCACAAAGATTAATCTTGG - Intronic
1094139391 12:27165248-27165270 AGTGGTACAAAGTTTCAGTTAGG - Intergenic
1094209998 12:27879025-27879047 AAGGACACAAAATTTCAGTTAGG - Intergenic
1094736394 12:33239623-33239645 AAGAGGACAAAGTTTCAGATTGG - Intergenic
1095622639 12:44276515-44276537 AAGGACAAAAAGTTTCAGTTAGG + Intronic
1096014669 12:48258775-48258797 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1096052302 12:48621305-48621327 AAGGGTACAAAGTTTCAGGTAGG + Intergenic
1096752859 12:53773603-53773625 ATGGGCACAGAGTTTTAGTTGGG + Intergenic
1097158757 12:57030780-57030802 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1097593950 12:61604455-61604477 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1098238047 12:68437609-68437631 ATGAGCACAGAGTTTCAGTTGGG + Intergenic
1098518583 12:71408650-71408672 AAGGGTACAAAGCTTCAGTTAGG + Intronic
1098940505 12:76529416-76529438 AGGCTCAAAAGGTTTCAGCTGGG - Intronic
1099256135 12:80315110-80315132 AAGGGCACAAAGTTTCAGCTAGG + Intronic
1100476224 12:94938152-94938174 ATGGGCACAGTGTTTCAGTTTGG + Intronic
1100625708 12:96329165-96329187 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1101708918 12:107247033-107247055 ATAGGAACAGAGTTTCAGCTTGG + Intergenic
1102138895 12:110598231-110598253 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1102968635 12:117148554-117148576 AGTGGCACAGAGTTTAAACTGGG + Intronic
1103037425 12:117667701-117667723 AGGTGCACAAAGTTACAGCAGGG + Intronic
1103992473 12:124808349-124808371 AGGGTCACAGATTTTCAGCAGGG - Intronic
1104412861 12:128573727-128573749 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1104452747 12:128884426-128884448 AAAAGCACAAAATTTCAGCTAGG + Intronic
1104742270 12:131186963-131186985 ATAGGCACAAAGTTACAGTTAGG + Intergenic
1106014593 13:25856709-25856731 ATGAGCACAGAGTTTCAGTTTGG - Intronic
1106200234 13:27530229-27530251 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
1106357678 13:28999726-28999748 ATGGGTACAAAGTTACAGTTAGG - Intronic
1106397149 13:29392183-29392205 ATAGGTACAAAGTTTCAGTTTGG - Intronic
1106890235 13:34236986-34237008 AAGGGTACAAAATTTCAGTTAGG - Intergenic
1107593566 13:41936634-41936656 AAGGATACAAAATTTCAGCTAGG + Intronic
1108108656 13:47042966-47042988 AGGGGCATAAAGTTTCAGTTAGG + Intergenic
1108175596 13:47789604-47789626 ATGGGTACAAAGTTTCACTTAGG + Intergenic
1108575995 13:51791717-51791739 AAGGGCACAAAGTTTCAGTTAGG - Intronic
1108728798 13:53210472-53210494 AAGGGTACAAAGTTTCAGTGAGG + Intergenic
1109395153 13:61747092-61747114 AAGGGTACAATGTTTCAGTTAGG + Intergenic
1110781336 13:79469051-79469073 ATGGGTACACAGTTTCAGTTTGG + Intergenic
1110992165 13:82055899-82055921 ATGGGTACAGAATTTCAGCTGGG + Intergenic
1112022422 13:95383283-95383305 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1112312556 13:98332190-98332212 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1112346414 13:98593711-98593733 ATGGGCACAAAGTTTCAGTTTGG - Intergenic
1112526137 13:100149423-100149445 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1112648698 13:101366880-101366902 AAGGGTACAAAGTTTCAGCTAGG - Intronic
1113499636 13:110763291-110763313 ATGGGCACAGAGTTTCACTTTGG - Intergenic
1113736516 13:112682439-112682461 ATAGGCACAGAGTTTCAGTTTGG - Intronic
1114324288 14:21573375-21573397 AAAGGTACAAAGTTTCAGCTGGG + Intergenic
1114695760 14:24626037-24626059 AAGAGTACAAAGTTTCAGTTAGG + Intergenic
1115280123 14:31652321-31652343 AAGGACACAAAGTTTCAGTTAGG + Intronic
1115669148 14:35589288-35589310 AGGGACACAAAATTTAAGTTAGG + Intronic
1115791502 14:36884092-36884114 AAGGGTACAAAGTTTCAGCAAGG - Intronic
1115954527 14:38763507-38763529 AGGAGCACAAAGTTAAAGCTAGG - Intergenic
1116380081 14:44256305-44256327 ATAGGTACAAAGTTTCAGTTAGG + Intergenic
1116399986 14:44494892-44494914 AAAGGTACAAAGTTTCAGTTAGG - Intergenic
1116665600 14:47770325-47770347 AAAGGTACAATGTTTCAGCTAGG + Intergenic
1116830720 14:49716833-49716855 ATGGGCACAGAGTTTCTGTTTGG - Intronic
1117127963 14:52651896-52651918 ATGGGTACAAAGTTTCAGTTAGG - Intronic
1117146116 14:52838310-52838332 AGGGGTATAGAGTTTCAGTTTGG - Intergenic
1117612377 14:57498149-57498171 ATGGGTACAAAGTTACAGTTAGG - Intergenic
1117890707 14:60418828-60418850 AAGGGTAAAAAGTTTCAGTTAGG + Intronic
1117895998 14:60487232-60487254 AAGGGTACGAAGTTTCAGTTAGG - Intronic
1118287412 14:64488775-64488797 ATGGGTACAAAGTTTCTGTTTGG + Intronic
1118733626 14:68686726-68686748 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1118885434 14:69861827-69861849 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1119279660 14:73394652-73394674 AAGGGTACAAAGTTTCGGTTAGG - Intronic
1119562559 14:75602699-75602721 ACGGGTACAGAGTTTCAGATTGG + Intronic
1120014078 14:79450313-79450335 AAGGGTACAAAATTTCAGTTAGG + Intronic
1120161582 14:81151357-81151379 AAGGGTACAAAGTTTCAGCTAGG - Intergenic
1121086556 14:91150921-91150943 ATGGGCAGAGAGTTTCAGTTTGG - Intronic
1121230937 14:92357712-92357734 ATGGGCACAGAGTTTCGGTTTGG + Intronic
1121235311 14:92387674-92387696 ATGGGTACAGAGGTTCAGCTTGG - Intronic
1122158445 14:99765343-99765365 GTGGGCACAGAGTTTCCGCTTGG - Intronic
1123634964 15:22295931-22295953 AAGGGTATAAAGTTTCAGATAGG - Intergenic
1124012002 15:25846179-25846201 ACGGGCACAAAGTTTCCGTTTGG + Intronic
1124095825 15:26648108-26648130 ATGGGCACAGAGTTCCAGTTGGG - Intronic
1124798290 15:32804143-32804165 AAGGGTATAAAGTTTCAGTTGGG + Intronic
1125396525 15:39254570-39254592 ACGGATACAAAGTTTCAGTTAGG + Exonic
1125553223 15:40563538-40563560 ATGGGTACACAGTTTCAGTTTGG + Intronic
1126226380 15:46274989-46275011 AGAGGCACAAAGTTACAGTTAGG + Intergenic
1126296398 15:47141503-47141525 ATGGATACAAAATTTCAGCTAGG + Intergenic
1126502455 15:49361049-49361071 AAGAGGACAAAGTTTCAGTTAGG + Intronic
1127312393 15:57764094-57764116 ATGGGTACATAGTTTCAGTTTGG - Intronic
1127447938 15:59084719-59084741 ATGGGTACAAAGCTTCAGCTGGG - Intronic
1127585502 15:60374040-60374062 TGGGGCACACAGTCTCAACTCGG + Intronic
1127695829 15:61446279-61446301 ATGGATACAAAGTTTCAGTTTGG + Intergenic
1128270231 15:66302944-66302966 AGGGGTATAGAGTTTCAGTTAGG - Intronic
1128394621 15:67211378-67211400 AGGGGACCAAAGTTTCAGCAGGG + Intronic
1128473339 15:67975114-67975136 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1128585426 15:68845327-68845349 ATGGGCACAAAGTTTCAGTTTGG - Intronic
1129210513 15:74065380-74065402 GGGGGCACAAGTTTTCAGCAAGG - Intergenic
1129952923 15:79607741-79607763 ATGGGCACAGAGTTTCTGCTTGG + Intergenic
1131278152 15:90999612-90999634 TGGGTAACAAAGTGTCAGCTGGG - Intronic
1131906699 15:97150352-97150374 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1132057980 15:98666770-98666792 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1133028647 16:2999335-2999357 AGAGGGACAAACTCTCAGCTAGG + Intergenic
1133253325 16:4499543-4499565 AAGGGTACAAAATTTCAGTTAGG + Intronic
1133843941 16:9436947-9436969 AAGGACACAAAATTTCAGTTAGG + Intergenic
1133946389 16:10352479-10352501 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1134088384 16:11374450-11374472 ATGGGGATAAAGTTTCAGTTTGG - Intronic
1135357165 16:21778994-21779016 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135455669 16:22595110-22595132 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1135459748 16:22631405-22631427 AAGGGTACAAAGCTTCAGTTAGG - Intergenic
1135866735 16:26110001-26110023 ATGGGTACAAAGTTTCACTTAGG - Intronic
1136148479 16:28330402-28330424 AGGGGCACACAGCTGCCGCTGGG - Intergenic
1136254777 16:29030666-29030688 AGTGTCACCAAGGTTCAGCTTGG - Intergenic
1136858859 16:33683074-33683096 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1137295376 16:47087470-47087492 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1137390542 16:48077614-48077636 GTGGGCACAGAGTTTCAGTTTGG + Intergenic
1137980988 16:53069393-53069415 ATGGGGACAGAGTTTCAGCTTGG - Intronic
1138639671 16:58374594-58374616 AGGAGTATAGAGTTTCAGCTTGG - Intronic
1139671630 16:68496252-68496274 AATGCCACAGAGTTTCAGCTGGG + Intergenic
1139935298 16:70566175-70566197 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1139993298 16:70957095-70957117 ATGGGTACAGAGTTTCAGTTCGG - Intronic
1140627212 16:76808535-76808557 GTGGGTACAGAGTTTCAGCTTGG - Intergenic
1203120433 16_KI270728v1_random:1531568-1531590 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1142929717 17:3272760-3272782 AAGGGCACAAAGTTTCAATTAGG + Intergenic
1143087277 17:4425572-4425594 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
1143607682 17:7998969-7998991 ATGGGCACAGAGTTTCAATTGGG + Intergenic
1143673869 17:8416148-8416170 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1144053688 17:11519517-11519539 TTGGGGACAGAGTTTCAGCTAGG + Intronic
1144132599 17:12261052-12261074 CTGGGCACAGAGTTTCAGTTTGG - Intergenic
1144525568 17:15986697-15986719 AAGGGTACAAAATTTCAGTTAGG + Intronic
1145065854 17:19760776-19760798 ATGGACACAGAGTTTCAGTTTGG - Intergenic
1147197389 17:38776378-38776400 ATGGGTATAGAGTTTCAGCTGGG + Intronic
1148636922 17:49156130-49156152 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1148705211 17:49624168-49624190 AGGGGTACAAAGTTGCAGATGGG + Intronic
1148713118 17:49696381-49696403 AGAAGCACTATGTTTCAGCTGGG - Intergenic
1149316974 17:55447789-55447811 ATGGGCACAGAGTTTCTGCTTGG - Intergenic
1149478340 17:56982216-56982238 AGGGGCCCAGGGTTCCAGCTGGG - Intronic
1150035311 17:61790071-61790093 AGGGGCACAAAGGAACATCTGGG - Intronic
1150053432 17:61988921-61988943 GGGGACACAAAATTTCAGTTGGG - Intronic
1150353217 17:64461731-64461753 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1150474208 17:65462066-65462088 ATGGGCACAAAGGATCAGTTTGG - Intergenic
1152393355 17:80016288-80016310 AGGGGGACAGAGCTTCAGCTTGG + Intronic
1152931165 17:83110779-83110801 ATGGGGACAGAGTTTCGGCTCGG - Intergenic
1153630410 18:7063880-7063902 AGGGGTACAGAGTTTCTGTTTGG + Intronic
1153836027 18:8964878-8964900 ATGAGCACAAAGTTTCAGTTTGG + Intergenic
1153883474 18:9440762-9440784 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1154138658 18:11803197-11803219 ATGAGCACAAAGTTTCATTTTGG - Intronic
1154976802 18:21465210-21465232 AAGGACACAAAATTTCAGTTAGG - Intronic
1155150000 18:23115685-23115707 ATGGGTACAGAGTTTCAGCTGGG - Intergenic
1155468152 18:26162268-26162290 AAGGGTACAAAGTTTCAGTCAGG - Intronic
1155520641 18:26665052-26665074 AGGGGTACAGAGTTTCAATTTGG + Intergenic
1155531356 18:26770290-26770312 ATGGGTACAGAGTTTCACCTGGG - Intergenic
1155770297 18:29689469-29689491 AAGGACACAAAGTTTTAGTTAGG + Intergenic
1156138227 18:34070986-34071008 ATGGGTACAAAGTTACAGTTAGG + Intronic
1156323437 18:36050107-36050129 ATGGATACAAAGTTTCAGTTTGG + Intronic
1157593479 18:48849984-48850006 ATGGGGACAGAGTTTCAGCTGGG - Intronic
1157606836 18:48931187-48931209 ATGGGAACAAAGTTTCAGCTAGG + Intronic
1157618067 18:48999257-48999279 ATGGGAACAGAGTTTCAGTTTGG - Intergenic
1158119404 18:54031509-54031531 ATGGGCACAGAGTCTCAGTTTGG + Intergenic
1158168239 18:54566271-54566293 ATGGGCACAAAGATTCATGTGGG - Intergenic
1158266904 18:55669280-55669302 AAGGGTACCAAGTTTCAGTTGGG + Intergenic
1160366672 18:78332107-78332129 AGGGGAACAGAGTTTCGGGTGGG + Intergenic
1160624479 18:80193511-80193533 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1161128572 19:2574347-2574369 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161245711 19:3250594-3250616 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1161276207 19:3419102-3419124 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161634905 19:5381852-5381874 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161749492 19:6084483-6084505 ATGGGGACAAAGTTTCAATTTGG - Intronic
1161902985 19:7133505-7133527 AAGGGTGCAAAGTTTCAGATGGG - Intronic
1161920610 19:7262872-7262894 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1161931465 19:7343364-7343386 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1161987840 19:7667142-7667164 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1162124597 19:8492631-8492653 ATGGGTACAAAGTTACAGTTAGG + Intronic
1162207228 19:9065145-9065167 AGGGGGACAAAGTGGAAGCTGGG + Intergenic
1162330164 19:10023221-10023243 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1162862994 19:13522104-13522126 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1162889678 19:13723446-13723468 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
1163087949 19:14996330-14996352 ATGGGCACTGAGTTTCATCTGGG + Intronic
1163165944 19:15498342-15498364 ACGGGGACAGAGTTTCAGCTGGG - Intronic
1163283921 19:16334387-16334409 ATGGGATCAAAGTTTCAGTTTGG - Intergenic
1163810295 19:19427160-19427182 ATGGGGATAGAGTTTCAGCTGGG + Intronic
1165598618 19:37033325-37033347 AAGGGTACAGAGTTTCAGTTTGG - Intronic
1167174362 19:47855209-47855231 ATAGGTACAAAGTTTCAGTTTGG - Intergenic
1167731110 19:51256541-51256563 AGGGGCACAAAGTTTCAGCTAGG + Intronic
925282922 2:2697308-2697330 AAGGGAACAAAGTTTCAGATGGG - Intergenic
926175529 2:10588349-10588371 ATGGGTACAGAGTTTCAGGTTGG - Intronic
926479314 2:13370227-13370249 AAGGGTATAAAGTTTCAGATAGG - Intergenic
926640292 2:15228852-15228874 ATAGGCACAAAGTTACAGTTGGG + Intronic
926722902 2:15975335-15975357 ATGGGTACAAAGTTTCAATTTGG + Intergenic
926940590 2:18132066-18132088 AGGGATACAAAGTTTCAATTAGG + Intronic
927499107 2:23570544-23570566 AGGGCCACACAGTTTCCCCTTGG + Intronic
927750841 2:25669143-25669165 AGGGGTACAGAGTTTCAGTTGGG + Intronic
928183412 2:29087397-29087419 AAGGGTACAAAGTTTCACTTAGG - Intergenic
928338420 2:30418987-30419009 AAGGACACAAAATTTCAGTTAGG + Intergenic
928596059 2:32860242-32860264 AAGGATACAAAGTTTCAGTTAGG - Intergenic
929102077 2:38324906-38324928 ATGGGCACAGAGCTTCAGCTGGG + Intronic
929239675 2:39641119-39641141 AAGGGTATAAAGTTTCAGTTAGG - Intergenic
930382738 2:50652355-50652377 ATGGGCACAAAGTTTCTTTTTGG - Intronic
930996050 2:57719751-57719773 ATGGGTACAGAGTTTCAGCTTGG + Intergenic
931602860 2:64020721-64020743 AAGGGTATAAAGTTTCAGGTAGG + Intergenic
932399999 2:71473830-71473852 ATGGGTATAGAGTTTCAGCTGGG - Intronic
932746738 2:74340062-74340084 ATGGGTATAAAGTTTCAGTTGGG + Intronic
932804923 2:74775194-74775216 ATGGGTACAAAGTTTCTGTTTGG + Intergenic
932833874 2:75016589-75016611 AAGGGTACAAAGTTTTAGTTAGG + Intergenic
932843284 2:75105406-75105428 AAGGGCACAAAGTGTCACTTAGG + Intronic
932970352 2:76533600-76533622 AGGCTCACAATCTTTCAGCTTGG + Intergenic
933080604 2:77979851-77979873 AAAGGCACAAAGTTTCAAGTTGG + Intergenic
933761851 2:85678016-85678038 ATGGGCACAGAGTTTCTGCTTGG - Intergenic
934089870 2:88541788-88541810 AGTGGTACAGAGTTTCAGTTTGG + Intergenic
934552265 2:95269674-95269696 AGCGGCACAGAGTTTTAGTTTGG + Intergenic
934705189 2:96472374-96472396 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
934898138 2:98136338-98136360 ATGGGCACAGGGTTTCAGTTTGG - Intronic
935073092 2:99713106-99713128 ATGGGCACAGAGTTTCAGTTTGG + Intronic
935186807 2:100742032-100742054 ATGGGTATAAAGTTTCAGTTAGG + Intergenic
935252727 2:101278773-101278795 AAAGGTACAAAGTTTCAGTTAGG - Intronic
935985450 2:108668323-108668345 ATGGGTACAAAGTTACAGTTAGG - Intronic
936696700 2:114958413-114958435 ACGGGTACAAAGTTTCAGCTGGG + Intronic
936988454 2:118335336-118335358 GAGGGCACAAAGCTTCAGTTAGG - Intergenic
937302142 2:120849206-120849228 ATGTGCACAGAGTTTCAGTTTGG + Intronic
938166437 2:129031411-129031433 ATGGGCACAAAGTTTAGGTTTGG + Intergenic
938249635 2:129804784-129804806 AGCAGCACAAAGCTGCAGCTTGG + Intergenic
939149031 2:138451150-138451172 ACAGGTACAAAGTTACAGCTGGG - Intergenic
940197321 2:151109691-151109713 ATGGGCACAGAGTTTCAGTTTGG - Intergenic
940212743 2:151272959-151272981 ATGGGTACAGAGTTTCAGTTTGG + Intronic
940688482 2:156884178-156884200 AGTGGGACAAAATTGCAGCTAGG - Intergenic
940801932 2:158142752-158142774 ATGAGCACAGAGTTTCAGTTTGG + Intergenic
940981577 2:160009556-160009578 ATGGGTACAGAGTTTCAGTTTGG + Intronic
941105093 2:161343183-161343205 ATGGGTACAGAGTTTCAGTTTGG - Intronic
941118407 2:161498926-161498948 AGGGGTACTAAGTTTCAGTTAGG - Intronic
941207928 2:162597580-162597602 AAGGGTGCAAAGTTTCAGTTAGG + Intronic
941208173 2:162601112-162601134 AGGGGAACAAAACTTCAGCTAGG - Intronic
941826974 2:169909531-169909553 AAGGGTACAAAGTTTTAGCTAGG + Intronic
942148983 2:173056215-173056237 ATGGGCACAGAATTTCAGTTTGG - Intergenic
942363863 2:175200936-175200958 ATGGGCACAGAGCTTCTGCTTGG + Intergenic
942617492 2:177809133-177809155 ATGGGTACAGAGTTTCAGTTTGG + Intronic
942756984 2:179352793-179352815 AAGGGTACAAAGTTTCAGCTGGG - Intergenic
942762762 2:179419226-179419248 AAGGACACAAAATTTCAGTTAGG + Intergenic
943050637 2:182909316-182909338 AAGGGAACAGAGTTTCAGTTGGG - Intronic
943964404 2:194314231-194314253 ATGGGCATAAAGTTTCAGTTGGG - Intergenic
944223682 2:197327839-197327861 AGAGACACAAAGATACAGCTGGG + Intergenic
944267129 2:197740766-197740788 GGGTGCACAGAGTTTCAACTTGG + Intronic
944733392 2:202537540-202537562 ATGGGTACAGAGTTTCAGTTTGG + Intronic
944762747 2:202833945-202833967 AAGGACACAAAATTTCAGTTAGG + Intronic
944894228 2:204147606-204147628 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
945108367 2:206338800-206338822 ATGGGTACAAATTTTCAGTTAGG - Intergenic
945598574 2:211828657-211828679 TGGGGCACTCAGTTTCATCTAGG - Intronic
946993691 2:225365991-225366013 ATAGGTACAGAGTTTCAGCTTGG - Intergenic
947890119 2:233610319-233610341 AGGGGTCCAAAGTTTCAGTTTGG - Intergenic
947891757 2:233629079-233629101 ATGGGTCCAAAGTTTCAGTTTGG - Intronic
948018172 2:234707178-234707200 AAGGGCACAAAGTTTCAGCACGG - Intergenic
948706308 2:239795571-239795593 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1168988025 20:2067446-2067468 ACGGGTACAGAGTTTCAGGTTGG + Intergenic
1169277133 20:4241276-4241298 ATGGGCATAAAGTTTCAGTTTGG + Intronic
1169895030 20:10494874-10494896 AGGGGTACAAAGTTTCAGTTAGG + Intronic
1169933459 20:10858218-10858240 CTGGGCACAATGTTTCAACTAGG + Intergenic
1170161073 20:13311821-13311843 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
1170257397 20:14360146-14360168 AGGGGTCCAAAATTTCAGTTAGG + Intronic
1170611136 20:17914537-17914559 ATGGGAATAGAGTTTCAGCTTGG + Intergenic
1170650210 20:18232583-18232605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1172651595 20:36506783-36506805 ATGGGTACAGAATTTCAGCTGGG - Intronic
1172675327 20:36666164-36666186 AGGGGCTCACATTTTCACCTCGG + Intronic
1172861516 20:38057414-38057436 AGGGGCACACATTTTCAGAATGG - Intronic
1172979929 20:38933291-38933313 ATGGGCACAGAGTTTCTGTTTGG + Intronic
1173030565 20:39355196-39355218 AAGGGTACAAAGTTTCAGTTTGG + Intergenic
1173449159 20:43147188-43147210 AGGAGGACACAGTTTCATCTTGG - Intronic
1174525409 20:51166571-51166593 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1174894351 20:54433121-54433143 AGGGATACAAAGTTTCAGTTAGG - Intergenic
1175000254 20:55620148-55620170 ATGAGCACAGATTTTCAGCTGGG + Intergenic
1175748921 20:61481333-61481355 TGGGGAACAGAGTTGCAGCTGGG + Intronic
1177512411 21:22106306-22106328 AAGAGCACAAAGTTTCAGTTAGG - Intergenic
1177843657 21:26263080-26263102 AGGGGCTAAAAGTCTGAGCTGGG + Intergenic
1178008719 21:28256760-28256782 AGGGGGACAAAATTGCACCTAGG - Intergenic
1178756378 21:35354090-35354112 ATGGGGACAAAGTTTCTGTTTGG - Intronic
1178758397 21:35375958-35375980 AAGGGCATAAAGTTGCAGTTAGG - Intronic
1178974800 21:37212363-37212385 AAGGGTAAAAAGTTTCAGTTAGG - Intergenic
1179948170 21:44694438-44694460 ATGGGGACAGAGTTTCAGTTCGG + Intronic
1180677677 22:17599147-17599169 ATGAGCACAAAGTTTCAGTACGG + Intronic
1181868415 22:25877863-25877885 AACGGCACAAAGTTTCCGTTAGG - Intronic
1182900724 22:33896050-33896072 AGGGGGAGACAGTTTCAGTTTGG - Intronic
1183473635 22:38023589-38023611 ATGGGCATACAGTTTCAGTTCGG - Intronic
1184016465 22:41789603-41789625 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1184267014 22:43353627-43353649 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1184518251 22:44976425-44976447 ATGGGTACAAAGTTACAGTTAGG - Intronic
949324606 3:2849283-2849305 AGGGATACAGAGTTTCAGTTTGG + Intronic
949863212 3:8525154-8525176 AAGGGTACAAAGTTTCAATTAGG - Intronic
949958951 3:9295762-9295784 ATGGGTACAGAGTTTCAGTTTGG - Intronic
950252845 3:11481190-11481212 ACCGGTACAAGGTTTCAGCTGGG + Intronic
950527161 3:13531150-13531172 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
950717460 3:14859712-14859734 AGGGGTACAAAGTTTCAAACAGG - Intronic
950881260 3:16324389-16324411 AAGGGTACAAAGTTTCAGTTAGG - Intronic
951775531 3:26306238-26306260 ATGGGTACAAAGTTTCACATGGG + Intergenic
952364396 3:32662105-32662127 AAGGGCACAAAGGTTCAGTCTGG + Intergenic
952773775 3:37025181-37025203 ATGGGCACAGAGTTTCAGTTTGG + Intronic
952929786 3:38350150-38350172 AGGTGCACAAAGGGTCAGCTGGG - Intronic
953231398 3:41068225-41068247 ATGGGCACAGAGTTTCAGTTGGG - Intergenic
953266621 3:41395648-41395670 ATAGGCACAGAGTTTCAGTTTGG + Intronic
953812785 3:46129024-46129046 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
953862752 3:46558954-46558976 AAGGGTACAAAGTTTCAGATAGG + Intronic
953920981 3:46951254-46951276 AAGGACACAAAGTTCCAGTTAGG + Intronic
955462194 3:59195431-59195453 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
955765335 3:62338521-62338543 ATGGGCATAGAGTTTCAGTTTGG + Intergenic
955771424 3:62388512-62388534 AAGGGTACAGAGTTTCAGTTAGG - Intergenic
956027585 3:64999861-64999883 ACGGGTACAGAGTTTCAGTTTGG + Intergenic
956088815 3:65641936-65641958 AGGGGCCCAAGGTTTCTGCCAGG + Intronic
957801221 3:85085173-85085195 AAGGTTACAAAGTTTCAGTTAGG - Intronic
958215524 3:90563868-90563890 AAGGGCACAAAATTTCCACTTGG + Intergenic
958215605 3:90568905-90568927 AAGGGCACAAAATTTCCACTTGG + Intergenic
959594974 3:108119886-108119908 AAGGGTACAAAGTTACAGTTAGG + Intergenic
959650594 3:108746763-108746785 AGTAACACAAAATTTCAGCTGGG + Intronic
959915561 3:111813173-111813195 AAGGATACAAAGTTTCAGCTTGG + Intronic
960020171 3:112941188-112941210 AAGGGCACAAAATTATAGCTAGG + Intronic
960216130 3:115039826-115039848 AAGGGTACAAAATTTCAGTTAGG + Intronic
960297316 3:115960033-115960055 AGGGACACAAATCTTCAGTTTGG - Intronic
960677163 3:120206665-120206687 AAGAGCACAAAGTTCCAGGTAGG - Intronic
960893516 3:122477304-122477326 AGGGATACAAAATTTCAGTTAGG + Intronic
961576311 3:127839505-127839527 GAGGGTACAAAGTTTCAGTTAGG + Intergenic
961617107 3:128191582-128191604 ATGGGTACAGAGTTTCAGTTTGG - Intronic
961945720 3:130685168-130685190 AAGAGTACAAAGTTTCAGTTAGG + Intronic
962182030 3:133216555-133216577 AAGGATACAAAGTTTCAGTTAGG - Intronic
963570767 3:146992608-146992630 ATGGGTAAAAAGTTTCAGTTTGG - Intergenic
964631795 3:158818458-158818480 AGGGGTACAAAGTTACAATTAGG - Intronic
964790226 3:160446991-160447013 ATGGGTACACAGTTTCAGTTTGG + Intronic
964827472 3:160844860-160844882 ATGGGTACAAAGCTTCTGCTTGG - Intronic
965032321 3:163388054-163388076 AAGGGAACAAAGTTTCAACTAGG + Intergenic
965675323 3:171189042-171189064 ATAGGTACAAAGTTTCAGCTGGG - Intronic
966290962 3:178359242-178359264 AAGGGTACAAAGTTTCAGCTAGG + Intergenic
966517897 3:180839427-180839449 AAGGACACAAAATTTCAGTTAGG - Intronic
966838881 3:184072098-184072120 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
967052148 3:185794782-185794804 ATGGGAACAGAGTTTCAGTTTGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968819748 4:2841891-2841913 ATGGGTACAGAGTTTAAGCTTGG - Intergenic
969136391 4:5032755-5032777 ATGGGGACAGAGTTTCAGCTTGG - Intergenic
969359557 4:6653915-6653937 ATGGGGACAAAGTTTCAGTTTGG + Intergenic
969371845 4:6736541-6736563 ATGGGGACAGAGTTTCAGTTGGG - Intergenic
969496630 4:7529987-7530009 AGGGTCACAAGGTTTCTCCTAGG - Intronic
970176421 4:13344103-13344125 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
970569681 4:17367602-17367624 ATGGGTACAAAGCTTCAGTTTGG + Intergenic
970670495 4:18391268-18391290 ATGGGCACAAGGTTTCATTTTGG + Intergenic
971209990 4:24606959-24606981 ATGGGCACAGATTTTCAGTTTGG + Intergenic
971411382 4:26376245-26376267 ATGAGCACAGAGTTTCAGTTTGG - Intronic
971434290 4:26603926-26603948 ATGGGTACAGAGTTTCAGCTTGG - Intronic
971474128 4:27056556-27056578 AGCGGCACCCTGTTTCAGCTTGG + Intergenic
972147465 4:36045574-36045596 AATGGTACAAAGTTTCAGTTAGG + Intronic
972508762 4:39747316-39747338 ATGGGTACGAAGTTTCAGTTTGG - Intronic
972823365 4:42728082-42728104 AAGTGTACAAAGTTTCAGTTAGG - Intergenic
973080638 4:45988002-45988024 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
974085079 4:57251665-57251687 AAGGTTACAAAGTATCAGCTGGG + Intergenic
974333161 4:60505801-60505823 AGGGACACCAAGATTCTGCTTGG - Intergenic
974498352 4:62663176-62663198 AAGGTTACAAAGTTTCAGTTAGG - Intergenic
974615732 4:64278715-64278737 AAGGATACAAAGTTACAGCTTGG - Exonic
975139515 4:70905000-70905022 TGGGGCACAATTTTTCAGTTAGG + Intronic
975162080 4:71135690-71135712 AAGGGTACAAAATTTCAGTTAGG - Intergenic
975763062 4:77636495-77636517 AGGGGCTCAAATTCACAGCTTGG - Intergenic
976117122 4:81739658-81739680 ATGGGCATGAAGTTTCAGCTTGG + Intronic
976143037 4:82012907-82012929 AAGGGTACAAAGTTACAGTTAGG + Intronic
976280751 4:83324793-83324815 ATGGGTACAGAGTTTCAGTTTGG + Intronic
976384802 4:84444471-84444493 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
976503304 4:85816267-85816289 AAGGGTGCAAAGTTTCAGTTAGG - Intronic
976564057 4:86533276-86533298 ATGGGTACAGAGTTTCAGCATGG + Intronic
976726406 4:88219964-88219986 ATGGGCAAGAAGTTTCAGTTTGG - Intronic
978435107 4:108675896-108675918 AGGAGCACAAAATTTCAGTTAGG - Intergenic
978477892 4:109152906-109152928 ATGGGTACAGAGATTCAGCTGGG + Intronic
982253960 4:153434554-153434576 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
983187905 4:164721726-164721748 ATGGGTACAGAGTTTCAGATTGG - Intergenic
984004163 4:174288389-174288411 AAGGGTACAAAGTTTCAGTTAGG - Intronic
984897151 4:184551446-184551468 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
984926496 4:184811680-184811702 ACGGGCACAGAGTTTCAATTCGG + Intronic
984957432 4:185059324-185059346 ATGAGCACAGAGTTTCTGCTTGG - Intergenic
985001942 4:185494183-185494205 ATGGGCACAGAGTTTCTGTTTGG + Intergenic
985107791 4:186515738-186515760 ATGGGTACAGAGTTTCAGCTGGG + Intronic
985172457 4:187166447-187166469 ATGGGTATAGAGTTTCAGCTGGG + Intergenic
985232115 4:187830298-187830320 AAGGGTACCAAGTTTCAGTTAGG - Intergenic
985243827 4:187959311-187959333 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
985307269 4:188557037-188557059 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
986771057 5:10974066-10974088 ATGGGCACAGAGTTTCTGTTTGG - Intronic
989227242 5:39043496-39043518 ATGGGTACAAAGTTACAGTTAGG + Intronic
990930449 5:61084432-61084454 ATGGGCATGAAGTTTCAGTTTGG - Intronic
991244352 5:64493144-64493166 ATGGGCACAGAGTTTCTACTCGG + Intergenic
991453707 5:66780180-66780202 ATGGGTACAAAGTTTCAGTTTGG - Intronic
991518791 5:67470684-67470706 AAGGGTACAAAATTTCAGTTAGG - Intergenic
991656250 5:68906545-68906567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
992304907 5:75426806-75426828 ATGGACACAGAGTTTCAGCTGGG + Intronic
993182754 5:84575748-84575770 AAGGGTACAATGTTTCAGATGGG - Intergenic
993321135 5:86468389-86468411 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
993554898 5:89324185-89324207 AAGAGCACAAAGTCTCAGTTAGG - Intergenic
993687079 5:90950765-90950787 AGGGGAACAAAATTTCAACTTGG + Intronic
994275485 5:97832142-97832164 GGGGGGACAATGTTTAAGCTTGG + Intergenic
994727842 5:103457393-103457415 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
995007302 5:107215420-107215442 ATGGGTACGAAGTTTCAGTTTGG + Intergenic
995987850 5:118201613-118201635 ATGGGCACAGAGTTTCTGTTTGG + Intergenic
996072795 5:119153536-119153558 AAGGGTAAAAAGTTTCAGTTAGG - Intronic
996077342 5:119212172-119212194 GCGGGCACAAAGTTTCAGTTTGG - Intronic
996269821 5:121589815-121589837 ATGAGTACAAAGTTTCAGTTAGG + Intergenic
996632585 5:125652252-125652274 GTGGGTACAAAGTTTCAGTTAGG + Intergenic
997107796 5:131041045-131041067 AAGGGCACAAAGTTTCAGTTAGG + Intergenic
997169844 5:131706114-131706136 ATGGATACAGAGTTTCAGCTGGG + Intronic
997205635 5:132047545-132047567 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
997329563 5:133050073-133050095 AGGGATACAGAGTTTCAGTTTGG - Intergenic
997547801 5:134724074-134724096 AAGGGTACAAAATTTCAGTTAGG - Intronic
998494558 5:142576422-142576444 AGGGGGACAAAGTTTGTGGTTGG - Intergenic
998994015 5:147850955-147850977 ATGGGTACAAAGTTACAGTTAGG - Intergenic
999313272 5:150567205-150567227 AGGAGCACAAAGTTTCTCCTTGG + Intergenic
999695807 5:154188128-154188150 ATGGGTACAGAGTTTCAGTTGGG + Intronic
999795248 5:154982802-154982824 ATGGGTACAGAGTTTCAGTTGGG - Intergenic
1000296942 5:159920402-159920424 AGGGGGACAAAGTCTCAGAAAGG - Intronic
1000610988 5:163374036-163374058 AAGGGTACAAAGTTTTAGATAGG + Intergenic
1001472435 5:172024063-172024085 ATGGGCACAAAGTTTCTGTTTGG - Intergenic
1001511382 5:172325058-172325080 ATGGGCACACAGTTTCATTTTGG + Intergenic
1001908653 5:175495325-175495347 ATGGGGACAAAGTTTTAGTTGGG + Intronic
1001965898 5:175909624-175909646 AAGGACACAAAGTTCCAGTTAGG + Intergenic
1002147929 5:177200535-177200557 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1002251046 5:177929577-177929599 AAGGACACAAAGTTCCAGTTAGG - Intergenic
1002343655 5:178533318-178533340 ATGGGCACAAAGTTTCCGTGTGG - Intronic
1002858600 6:1059440-1059462 AAGGGGACAGAGTTTCAACTTGG + Intergenic
1003092673 6:3117625-3117647 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1003161759 6:3641702-3641724 AAGTGTACAAAGTTTCAGTTAGG + Intergenic
1003531843 6:6943633-6943655 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1003536264 6:6978260-6978282 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1003549329 6:7088193-7088215 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1003820364 6:9889480-9889502 AAGGGTACAAAGTTTCAAATAGG + Intronic
1004735091 6:18397945-18397967 ACGGGTACAGAGTTTCTGCTTGG - Intronic
1004817356 6:19326567-19326589 AGAGTCACAAATTTACAGCTGGG - Intergenic
1004998141 6:21214192-21214214 AGGGTTACAGAGTTTCTGCTTGG + Intronic
1005062529 6:21790345-21790367 ATGGGTACAGAGTTTCAGGTTGG - Intergenic
1005320840 6:24651986-24652008 ATGGGTACAGAGTTTCAGTTGGG - Intronic
1005589201 6:27307591-27307613 AAGGGTACAAAGTTTCAGATAGG - Intronic
1007558879 6:42789137-42789159 ATGGGCGCAGAGTTTCAGTTTGG + Intronic
1008006140 6:46411354-46411376 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1008559881 6:52713439-52713461 AGTGGCACACTGTGTCAGCTGGG + Intergenic
1008675847 6:53817549-53817571 AAGGGTACAAAGTTTAAGTTAGG - Intronic
1010475958 6:76287583-76287605 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1010747033 6:79575244-79575266 AAGGACACAAAATTTCAGTTAGG - Intergenic
1010906008 6:81489837-81489859 AAGGGTACAAAATTTCAGTTAGG + Intergenic
1011471950 6:87716780-87716802 TTGGGTACAAAGTTTCAGTTAGG + Intergenic
1011659564 6:89582594-89582616 ATGGGTACAAAGTTACAGTTTGG - Intronic
1013252860 6:108352076-108352098 ATGGACACAGAGTTTCAGTTTGG - Intronic
1013420616 6:109963244-109963266 ATGGGTACAAAATTACAGCTAGG + Intergenic
1013988610 6:116227089-116227111 AAGGACACAAAATTTCAGGTAGG - Intronic
1014334054 6:120109171-120109193 AGGGGTACAAAGTTTCAGTTAGG - Intergenic
1014375220 6:120663992-120664014 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1014431684 6:121378387-121378409 AAGAGTACAAAGTTTCAGGTAGG - Intergenic
1015037215 6:128670176-128670198 ATGGGTACAAAGTTTCAGTTAGG + Intergenic
1015706410 6:136092814-136092836 AGGGGTACAAAGTCTCAGACAGG + Intronic
1016067165 6:139696573-139696595 AGCAGCTCAAATTTTCAGCTTGG - Intergenic
1016434158 6:144018412-144018434 AAGGACACAAAGTTTCAGTAAGG + Intronic
1016863200 6:148742492-148742514 AAGGATACAAAATTTCAGCTAGG - Intergenic
1017358579 6:153540032-153540054 AGGGGTACAGTGTTTCAACTTGG - Intergenic
1017846953 6:158266930-158266952 ATGGGCACAGAGTTTCAGTTTGG - Intronic
1018034368 6:159868717-159868739 ATGGGCACTAAGTTTCTGTTAGG + Intergenic
1018334123 6:162766178-162766200 ATGGGGACAAAGTTTCAGATAGG - Intronic
1018459196 6:163981316-163981338 ATGGGGACAAAGTTTCAGTTTGG + Intergenic
1018700207 6:166420371-166420393 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1019503416 7:1377118-1377140 ATGGGAACGAAGTTTCAGTTGGG + Intergenic
1019582402 7:1771934-1771956 AAGGGGACAAAGTTTCAGTTAGG - Intergenic
1019694261 7:2436256-2436278 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1019794866 7:3042165-3042187 CGGGGGACACAGTTTCAGTTTGG + Intronic
1019810351 7:3160623-3160645 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1019923318 7:4176610-4176632 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1020115565 7:5474203-5474225 ATGGGGACAGAGTTTCAGTTGGG + Intronic
1020174973 7:5874895-5874917 ATGGGGACAGAGTTTCAGATTGG - Intergenic
1020667699 7:11068556-11068578 AGGGGTACAGAGTTTCAGCTGGG + Intronic
1021442747 7:20697104-20697126 AAGGGCACAACATTTCAGCTAGG - Intronic
1021532406 7:21662714-21662736 AAGGACACAAAATTTCAGTTGGG - Intronic
1021538444 7:21730716-21730738 AGGGATACAAAATTTCAGTTAGG + Intronic
1021848638 7:24786682-24786704 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1021915702 7:25430314-25430336 ATGGGTACAAAGTTTCTGTTTGG - Intergenic
1021922767 7:25503249-25503271 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1023196879 7:37650560-37650582 AAGGGTACAAAGTTTCAGTTAGG - Intergenic
1023329723 7:39101602-39101624 AAGGGTAGAAAGTTTCAGTTAGG + Intronic
1023341238 7:39222526-39222548 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1023487219 7:40699979-40700001 AGGGGAAAAAAGTTTCAGGAAGG - Intronic
1023490111 7:40730651-40730673 AAGGACACAAAATTTCAGTTAGG - Intronic
1024960163 7:54966035-54966057 ATGGGTACAGAGTTTCTGCTTGG - Intergenic
1025771050 7:64507319-64507341 AAGGGTACAAAGTTTCAAATAGG + Intergenic
1026424380 7:70275422-70275444 ATGGGCACAAGGTTTCATTTTGG + Intronic
1026590079 7:71686822-71686844 AGGGGCAGTGAGTCTCAGCTCGG - Intronic
1028646209 7:93099290-93099312 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1029083805 7:97995748-97995770 ATGGGGACAGAGTTTCAGATTGG + Intergenic
1029148025 7:98460361-98460383 ATGGGGACAAAGTTTCAGTGTGG - Intergenic
1030043726 7:105475808-105475830 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1030044338 7:105481594-105481616 AGGGGTACAGAGTTTCATTTTGG - Intronic
1030199103 7:106884436-106884458 ATGGGTACAGAGTTTCAGCTGGG - Intronic
1030233918 7:107238112-107238134 AAGGGTACAAAGTTGCAGTTAGG - Intronic
1030619324 7:111772122-111772144 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1030790822 7:113726052-113726074 AGAGGTATAAAGTTTCAGTTAGG + Intergenic
1032076242 7:128837477-128837499 AGGGGCACCAGGTTTGAGCTTGG - Exonic
1032537436 7:132676758-132676780 ATGGGCACAGAGTTTCAGTCTGG - Intronic
1033218916 7:139514909-139514931 AAGGGCACAAAGTTTCCCTTAGG - Intergenic
1033432572 7:141302522-141302544 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1034514537 7:151564639-151564661 TGGGGAACAAGGTTTCTGCTGGG + Intronic
1034695957 7:153053918-153053940 AAAGGCACAAAGTTTCAGTTAGG - Intergenic
1035109058 7:156465047-156465069 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1035147831 7:156838330-156838352 AAGGGTACAAAATTTCAGTTAGG - Intronic
1035205344 7:157290868-157290890 ATGGGGACAGAGATTCAGCTTGG + Intergenic
1035540179 8:428660-428682 ATGGGGACAGAGTTTCAGTTTGG - Intronic
1036015773 8:4782146-4782168 ATGGGTACAAAGTTACAGTTAGG + Intronic
1036137710 8:6176860-6176882 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1036651060 8:10644338-10644360 AGGGTCACAGAATTTCAGCATGG - Intronic
1036705942 8:11047024-11047046 AAGGGCACAAAGTTTCAATTCGG + Intronic
1036720433 8:11169656-11169678 ACGGGTACAGAGTTTCTGCTAGG + Intronic
1036821806 8:11946071-11946093 ATGGGCACAGAGTTTCAGTTTGG + Intergenic
1037537153 8:19835404-19835426 AGGGGCACATGGTTTGAGTTAGG + Intronic
1037710287 8:21349968-21349990 AAGGGTACAAAATTTCAGTTAGG + Intergenic
1038155549 8:24985983-24986005 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1038208964 8:25497601-25497623 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1038371306 8:26994578-26994600 ATGGGTGCAGAGTTTCAGCTGGG + Intergenic
1038566996 8:28627956-28627978 ATGGGTACAGAGTTTCAGCCTGG + Intronic
1038624943 8:29182758-29182780 AAGGGTACAAAGTTTCTGTTAGG + Intronic
1038771307 8:30483721-30483743 AGGGCTACAGAGTTTCTGCTTGG - Intronic
1039209148 8:35192100-35192122 AAGGGTATAAAGTTTCAGTTAGG - Intergenic
1039677946 8:39690652-39690674 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1039975935 8:42364819-42364841 AATGGCACAGAGTTTCAGTTGGG + Intronic
1040037258 8:42882734-42882756 ATGGGCATAAAGTTTCTGTTAGG + Intronic
1040456029 8:47598892-47598914 AGACTCACAAAGTTTCAGTTCGG - Intronic
1040994098 8:53384013-53384035 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1041029212 8:53718888-53718910 AGGCTCACAAAGTTCCACCTGGG - Intronic
1041379565 8:57239656-57239678 ATGGGCACAGAGTTTCTGTTTGG - Intergenic
1041460667 8:58108399-58108421 AGGAGCACAAAGAGTCAGCCTGG + Intronic
1041687564 8:60658329-60658351 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1041758664 8:61340310-61340332 AAGGACACAAAATTTCAGTTAGG - Intronic
1041986955 8:63933322-63933344 AAGGGTACAAAGATTCAGATAGG - Intergenic
1042952235 8:74212788-74212810 ATGGGTACAAAGCTTCAGTTTGG - Intergenic
1042959322 8:74286524-74286546 ATGGGTACAAAGTTACAGTTAGG - Intronic
1043550589 8:81367846-81367868 GAGGGTACAAAGTTGCAGCTGGG + Intergenic
1044449794 8:92321480-92321502 AGGGGAACATAGTATCATCTGGG + Intergenic
1044716949 8:95108581-95108603 ATGGGTAGAAAGTTTCTGCTTGG + Intronic
1044819989 8:96149610-96149632 AAGGGTACAAATTTTCAGTTAGG + Intronic
1045194752 8:99919233-99919255 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1045289467 8:100820143-100820165 GTGGGTACAAAGTTTCAGCTTGG + Intergenic
1045862096 8:106825085-106825107 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1046187070 8:110734932-110734954 AGGTGCCCAAAGTTTCAGAGGGG + Intergenic
1047365275 8:124205574-124205596 AGGAGCACAAATTTTCAGTAAGG - Intergenic
1047824487 8:128558796-128558818 AAGGACACAAATTTTCAGTTAGG + Intergenic
1048103866 8:131385825-131385847 ATGGGTACAGAATTTCAGCTTGG + Intergenic
1049916582 9:323625-323647 ACGGGTACAGAGTTTCAGTTTGG - Intronic
1050708177 9:8428083-8428105 AAGGTCACACAGTTTGAGCTAGG + Intronic
1051485440 9:17603496-17603518 ACGGGTACAGAGTTTCAGATGGG + Intronic
1052222109 9:26037325-26037347 AGGGCCAAATAGTTTCACCTGGG - Intergenic
1052334993 9:27309954-27309976 AAGGACACAAAATTTCAGCTAGG + Intergenic
1052344472 9:27395183-27395205 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1052581928 9:30368414-30368436 AAGGACACAAAGTTACAGTTAGG - Intergenic
1053112250 9:35471554-35471576 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1053324630 9:37132455-37132477 AGGGGCACAGAGTTATAGATAGG - Intronic
1054839932 9:69727275-69727297 AAGGGTACAAAGTTTCCGTTAGG - Intronic
1055245598 9:74238878-74238900 ATGGGTACAAAGTTTCAGTTTGG + Intergenic
1056083719 9:83123926-83123948 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1056419255 9:86407820-86407842 ATGGGCATAGAGTTTCAGTTTGG - Intergenic
1056538692 9:87553008-87553030 ATGGATACACAGTTTCAGCTTGG - Intronic
1056707485 9:88964403-88964425 AAGGGTACAAAGTTTTAGTTAGG + Intergenic
1057203311 9:93155405-93155427 ATGGGGACAGAGTTTCAGTTTGG - Intergenic
1057256108 9:93548449-93548471 AGGGGAACAGAGTTTCAGTCTGG + Intronic
1057842601 9:98498257-98498279 ATGGGCACAGAGTTTCAGTGTGG + Intronic
1058278998 9:103087199-103087221 AGCGGCATAAAGTTACAGTTAGG + Intergenic
1058853973 9:109041608-109041630 AAGGGTACAAAGTTTCAGTTAGG + Intronic
1058970989 9:110082819-110082841 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1059109910 9:111546802-111546824 AGGAGTACAGAGTTTCAGTTTGG - Intronic
1059182053 9:112225433-112225455 ATGGGTACAGAGTTTCAGTTTGG + Intronic
1059270704 9:113068789-113068811 AAGGGCACAAAGTTTCCGAGAGG + Intergenic
1059271838 9:113074236-113074258 AAGGGCACAAAGTTTCCGAGAGG + Intergenic
1059272972 9:113079683-113079705 AAGGGCACAAAGTTTCCGAGAGG + Intergenic
1059274108 9:113085125-113085147 AAGGGCACAAAGTTTCCGAGAGG + Intergenic
1059377763 9:113899260-113899282 ATGGGCATAGAGTTTCAGCCTGG - Intronic
1059586963 9:115617517-115617539 AGGGGCACCAAGTATCAGTGTGG + Intergenic
1059621371 9:116009349-116009371 ATGGGTACAGAGTTTCAACTGGG - Intergenic
1060263437 9:122094721-122094743 ATAGACACAAAGTTTCAGTTTGG - Intergenic
1060469423 9:123935379-123935401 ATGGGTATAAAGTTTCAGTTTGG - Intergenic
1061503356 9:131016276-131016298 ATGGGGACAGAGTTTCAGTTTGG + Intronic
1061560749 9:131401301-131401323 ATGGGAACAGAGTTTCAGTTTGG - Intronic
1061750380 9:132772942-132772964 AGGGGGACAAGGTAGCAGCTGGG - Intronic
1185987738 X:4854694-4854716 AAGAGTACAAAGTTTCAGTTAGG + Intergenic
1186031449 X:5373570-5373592 ATGGATACAGAGTTTCAGCTGGG - Intergenic
1186064987 X:5753628-5753650 AAGGGTACAAAGATTAAGCTTGG + Intergenic
1186193891 X:7093121-7093143 ATGGGGACAGAGTTTCACCTTGG - Intronic
1186439300 X:9571695-9571717 ATGAGGACAGAGTTTCAGCTTGG - Intronic
1186658483 X:11642812-11642834 ATGGGCACAAGGTTTCTTCTTGG + Intronic
1186764519 X:12757153-12757175 AGGGGCACAGAGTTTCAGTTTGG + Intergenic
1187059450 X:15771983-15772005 AAAGGTACAAAGTTTCAGTTAGG - Intronic
1187124026 X:16436602-16436624 GGGGGCACATAGTCTAAGCTTGG + Intergenic
1187309863 X:18131614-18131636 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1187820384 X:23281395-23281417 ATGGACACAAAGTTTCTGTTTGG + Intergenic
1188863610 X:35287149-35287171 AAGGACACAAAATTTCAGTTAGG + Intergenic
1188952539 X:36393952-36393974 CTGGGTACAGAGTTTCAGCTTGG - Intergenic
1189393600 X:40600117-40600139 AGGAGTACAGAGTTTCAGTTGGG - Intronic
1189467777 X:41290420-41290442 AGGGATACAAAATTTCAGTTTGG - Intergenic
1189621734 X:42847637-42847659 ATGGACAAAAATTTTCAGCTGGG - Intergenic
1189815996 X:44824441-44824463 ATGGGGACAGAGTTTCAGTTTGG + Intergenic
1189844561 X:45121903-45121925 AAAGGTACAAAGTTTCAGTTAGG + Intergenic
1189901175 X:45707883-45707905 ATGGGCACAGAGTTTCTGTTTGG + Intergenic
1190001921 X:46697197-46697219 AAGGATACAAAGTTTCAGTTAGG + Intronic
1190942849 X:55059729-55059751 AAGGGTTCAAAGTTTCAGTTAGG - Intergenic
1191615633 X:63167071-63167093 AGTGGCACAAAATTTGTGCTTGG + Intergenic
1191620665 X:63211852-63211874 AGTGGCACAAAATTTGTGCTTGG - Intergenic
1192262455 X:69513873-69513895 ATGGGCACAGAGTTTCTGTTTGG - Intronic
1192264728 X:69530511-69530533 AGGTGCACACAGTTGCAGCTAGG + Exonic
1192268073 X:69554030-69554052 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1192413608 X:70957153-70957175 ATGGATACAAAGTTTCAGTTGGG + Intergenic
1193131015 X:77919889-77919911 ATGGGTACAGAGTTTCAGTTTGG - Intronic
1193242517 X:79187820-79187842 ATGGATACAAAGTTTCAGTTTGG - Intergenic
1193516185 X:82467620-82467642 AGAGGTACAAAGTTTCACTTAGG - Intergenic
1193519884 X:82516213-82516235 ATGGGTACATAGTTTCTGCTTGG + Intergenic
1193890448 X:87038757-87038779 AAGGGTACAAAGTTCCAGTTAGG + Intergenic
1194104103 X:89746999-89747021 ATGGGCAGAGAGTTTCAGTTTGG + Intergenic
1194253700 X:91610061-91610083 ATGGGTACAAAGTTACAGCAAGG + Intergenic
1195280214 X:103326014-103326036 ACGGGCACAAAGTTTCAGTTTGG - Intergenic
1195521457 X:105835143-105835165 ATGGGCACACTTTTTCAGCTAGG + Intronic
1195677588 X:107519097-107519119 ATGGGTACAGAGTTTCAGTTTGG + Intergenic
1196515774 X:116608669-116608691 AAGGACACAAAATTTCAGTTAGG - Intergenic
1197179908 X:123523116-123523138 ATGGGCGTAGAGTTTCAGCTGGG - Intergenic
1197231083 X:124004313-124004335 ATGGGTATAGAGTTTCAGCTGGG - Intronic
1197552690 X:127913349-127913371 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1197590288 X:128401180-128401202 AGGGGTACAAAGTTTCATTTAGG + Intergenic
1198992807 X:142535572-142535594 ATGGGCACAGAGCTTCAGTTTGG - Intergenic
1199154504 X:144530760-144530782 AAGGGTACAAAGTTTCAGTTAGG + Intergenic
1199287879 X:146074096-146074118 ATGGGTACAGAGTTTCAGTTTGG - Intergenic
1199426787 X:147711625-147711647 GGGGGTACAAAATTTCAGTTAGG - Intergenic
1199440446 X:147862077-147862099 ATGGGTACAGAGTTTCAGTTGGG + Intergenic
1200572483 Y:4849641-4849663 ATGGGTACAAAGTTACAGCAAGG + Intergenic
1202195269 Y:22294504-22294526 AGGGGCACAAGGGGTCAGCCAGG + Intergenic
1202232755 Y:22672352-22672374 AGGGGCACACAGGGTCAGCCAGG - Intergenic
1202310401 Y:23523806-23523828 AGGGGCACACAGGGTCAGCCAGG + Intergenic
1202560401 Y:26146788-26146810 AGGGGCACACAGGGTCAGCCAGG - Intergenic