ID: 1167733641

View in Genome Browser
Species Human (GRCh38)
Location 19:51277932-51277954
Sequence CTGAGTAAACAGGCGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167733636_1167733641 -4 Left 1167733636 19:51277913-51277935 CCATGACACGGGGAGTGGCCTGA No data
Right 1167733641 19:51277932-51277954 CTGAGTAAACAGGCGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167733641 Original CRISPR CTGAGTAAACAGGCGGAGGA AGG Intergenic
No off target data available for this crispr