ID: 1167734146

View in Genome Browser
Species Human (GRCh38)
Location 19:51281587-51281609
Sequence CTCTGGTCTTCAAAGACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167734146_1167734151 30 Left 1167734146 19:51281587-51281609 CCCTCAGTCTTTGAAGACCAGAG No data
Right 1167734151 19:51281640-51281662 TTCTCTTCAGTTTTATCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167734146 Original CRISPR CTCTGGTCTTCAAAGACTGA GGG (reversed) Intergenic
No off target data available for this crispr