ID: 1167734152

View in Genome Browser
Species Human (GRCh38)
Location 19:51281647-51281669
Sequence CAGTTTTATCACCTGGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167734150_1167734152 -6 Left 1167734150 19:51281630-51281652 CCTTGAGTAGTTCTCTTCAGTTT No data
Right 1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG No data
1167734149_1167734152 20 Left 1167734149 19:51281604-51281626 CCAGAGTTCAGGTTCAAGCTCTA No data
Right 1167734152 19:51281647-51281669 CAGTTTTATCACCTGGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167734152 Original CRISPR CAGTTTTATCACCTGGACGC TGG Intergenic
No off target data available for this crispr