ID: 1167743303

View in Genome Browser
Species Human (GRCh38)
Location 19:51337510-51337532
Sequence AGCCTCCACGAGGATATGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167743298_1167743303 11 Left 1167743298 19:51337476-51337498 CCAAGTCAGCACGGCTGCATCTC 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1167743296_1167743303 18 Left 1167743296 19:51337469-51337491 CCACATCCCAAGTCAGCACGGCT 0: 1
1: 0
2: 0
3: 13
4: 184
Right 1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1167743293_1167743303 26 Left 1167743293 19:51337461-51337483 CCCGCGCTCCACATCCCAAGTCA 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1167743297_1167743303 12 Left 1167743297 19:51337475-51337497 CCCAAGTCAGCACGGCTGCATCT 0: 1
1: 0
2: 1
3: 16
4: 108
Right 1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1167743294_1167743303 25 Left 1167743294 19:51337462-51337484 CCGCGCTCCACATCCCAAGTCAG 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1167743292_1167743303 27 Left 1167743292 19:51337460-51337482 CCCCGCGCTCCACATCCCAAGTC 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167743303 Original CRISPR AGCCTCCACGAGGATATGGA GGG Exonic
902288738 1:15423160-15423182 AGCCTCCACCTGGAGCTGGAGGG - Intronic
902797510 1:18808952-18808974 TGCCTCCTCCAGGATTTGGAGGG - Intergenic
904697268 1:32337383-32337405 AGCCCCCAGGAGGAAAGGGATGG + Intergenic
905855925 1:41313845-41313867 AGCCTCCAGGAGGCTAGGGTGGG + Intergenic
920297590 1:204968392-204968414 ACCCTCCAGGAGGATGGGGATGG + Intronic
920349954 1:205331367-205331389 ACGCTCCACAAGGATATGGTCGG + Intergenic
920513169 1:206565639-206565661 ATCTTCCACTAGGATATGGAAGG - Intronic
1063209918 10:3870735-3870757 AGCCTCCAGGAGGATGGGCATGG + Intergenic
1066522482 10:36237953-36237975 AGTCTCCACGAATATATGTATGG - Intergenic
1067833449 10:49623344-49623366 AACCTCCACGTGGATATGCATGG - Intronic
1067973187 10:50993707-50993729 AGATTTCACCAGGATATGGAGGG + Intronic
1069072400 10:64002790-64002812 ATCCTTCACAGGGATATGGATGG + Intergenic
1070509977 10:77152238-77152260 AGTCTCCAAGAGGTTATGGAAGG - Intronic
1071874201 10:89826636-89826658 AGTCTCCATGAGGGTAAGGATGG - Intergenic
1072247003 10:93552674-93552696 TGCCTCCACTAGGGGATGGATGG + Intergenic
1074523031 10:114241901-114241923 AGCCTCCTTGATGATAGGGAGGG - Intronic
1080411603 11:32029961-32029983 AGCCCTCACCAGCATATGGAGGG - Intronic
1080584113 11:33666094-33666116 AGCCTCCCTGTGGATTTGGAGGG - Intronic
1083076656 11:60046790-60046812 AGAGTCCACGAGGATCTAGAAGG + Intronic
1083876971 11:65529386-65529408 AGCCTCCAGGAGAACATGGGAGG + Intronic
1084922789 11:72484958-72484980 AGCCTCTAGGAGAATATGGGTGG + Intergenic
1085459480 11:76684856-76684878 AGCATCCATGAGCATATGCATGG - Intergenic
1087893840 11:103565517-103565539 AGCCACCAAGAGAAGATGGATGG + Intergenic
1103364537 12:120371578-120371600 AGCCTACAGGAGGAAAAGGAAGG + Intergenic
1103733513 12:123043922-123043944 AGCCTCCAAGATGATAAGCATGG + Intronic
1104482033 12:129115893-129115915 AGCCTTCTTGAGGACATGGAGGG + Intronic
1110457414 13:75705099-75705121 AGCCTACCCGAGCATATGAAGGG - Intronic
1120284985 14:82488595-82488617 AGTCACCCCAAGGATATGGAAGG - Intergenic
1120868384 14:89315764-89315786 AGCCACCAGGAGAATATGGCTGG - Intronic
1126196338 15:45936097-45936119 AAGGCCCACGAGGATATGGAGGG - Intergenic
1128785838 15:70396340-70396362 AGCCTCCACTCAGATGTGGAGGG - Intergenic
1135405237 16:22192916-22192938 AGCCTCCATGAGGTTCTGAAAGG + Intergenic
1138565144 16:57827659-57827681 AGCAACCACGAGGCCATGGATGG + Intronic
1142528267 17:560517-560539 AGCCTCCTCAAGGAAAAGGAGGG - Exonic
1144369296 17:14574789-14574811 GGCCTCCAAGAGTAAATGGATGG + Intergenic
1155438147 18:25834182-25834204 AGGCACCACGAGGCTATAGAAGG - Intergenic
1158947022 18:62455900-62455922 AGACTTCACTAGGATGTGGAAGG + Intergenic
1164511984 19:28904906-28904928 AGCCACCACTGGGATATGGCGGG + Intergenic
1167743303 19:51337510-51337532 AGCCTCCACGAGGATATGGAGGG + Exonic
1168072180 19:53959424-53959446 AGCCTCGGAGAGGAGATGGATGG - Intergenic
924989552 2:300747-300769 AGCATCTAAGAGGATATGGGTGG - Intergenic
926059691 2:9797456-9797478 TGCCTTCACAAGGATCTGGAAGG - Intergenic
928404556 2:31004651-31004673 AGCCTCCAACAGGACAGGGAGGG + Intronic
933766318 2:85711854-85711876 AGCCTCCAGGAGGACAAGAATGG + Intergenic
936689324 2:114867702-114867724 TGCCTCCACGATGTCATGGAAGG + Intronic
936937700 2:117853990-117854012 AGGCTCCCCGAGGATATGGCTGG - Intergenic
936937712 2:117854042-117854064 AGGTTCCCCGAGGATATGGCTGG - Intergenic
936937724 2:117854094-117854116 AGGCTCCCCGAGGATATGGCTGG - Intergenic
938997109 2:136691745-136691767 AGACTCCAAGAGGATATAGATGG + Intergenic
940842434 2:158599377-158599399 AACCTCCATGAGGGTATGGCAGG - Intronic
941346728 2:164378346-164378368 AGCCTATAAGAGGATATGGCAGG - Intergenic
947950809 2:234145566-234145588 AGCCTCCCCCAGAATTTGGAGGG - Intergenic
948907958 2:240988820-240988842 AGCCTGCACCAGGAGGTGGACGG + Intronic
1173094988 20:40017533-40017555 ATCATCTACGAGGAAATGGATGG - Intergenic
1179393028 21:41011175-41011197 GGCCTCCCCGAGGACATGCAGGG + Intergenic
1179643577 21:42762163-42762185 AGGCTCGGCGAGGATCTGGAAGG - Exonic
1180704815 22:17802797-17802819 AGCCTCCACGGGGAGATGAAGGG + Intronic
1184147625 22:42620522-42620544 AGCGCCCACGATGATATGGCTGG + Intronic
949616267 3:5757055-5757077 AGGCACCATGAGGATATGGGTGG + Intergenic
953447225 3:42978911-42978933 AGTCCCCAAGAGGATTTGGAAGG - Intronic
954628422 3:52035446-52035468 AGACTCCACGAGGGTAGGGCTGG - Intergenic
955027459 3:55183515-55183537 AGGCTCCAGGGGGATGTGGAGGG + Intergenic
959081330 3:101804361-101804383 AGCCTCACCCAGGATATGCAAGG - Intronic
959925032 3:111911422-111911444 AACCTCCAAGAGCATATGTAAGG - Intronic
967765660 3:193276802-193276824 ACCCTCCACGATGTTATGGTTGG + Exonic
982284880 4:153724475-153724497 AGACTCCAAGAGGATGTGCAGGG - Intronic
999019255 5:148145063-148145085 AGCCTCTACAAGGATAGAGAAGG + Intergenic
1001390016 5:171371255-171371277 AACCTCAACGAGGTTCTGGAAGG - Intergenic
1003184882 6:3822001-3822023 AGCATCCAGGAGGATGGGGAGGG + Intergenic
1005996006 6:30931907-30931929 AGCTTCCAAGAGGCTCTGGAGGG - Intronic
1006238670 6:32658491-32658513 AGCTTCTGCGAGGTTATGGAAGG - Intergenic
1009400897 6:63254360-63254382 AGCCTCCAGGAGGATTTTGTTGG - Intergenic
1017529634 6:155275934-155275956 AGCCTGCACGTGGATGGGGAGGG - Exonic
1023427170 7:40050138-40050160 AGCGTCCACTAAGAGATGGACGG - Intronic
1026353622 7:69538709-69538731 AGCCTCCAGGAGGCTATGACAGG + Intergenic
1029654029 7:101912654-101912676 AGCCTATGCGAGCATATGGATGG + Intronic
1033478135 7:141710713-141710735 AGCATCCACCAAGTTATGGAGGG + Intronic
1046149684 8:110207256-110207278 ATCCTTCGCAAGGATATGGATGG - Intergenic
1057303401 9:93899265-93899287 AGCCTCCACCAGGAAAAGTAGGG + Intergenic
1058529199 9:105889230-105889252 AGCCTCCATGGGGATGGGGATGG - Intergenic
1059981430 9:119776625-119776647 AACCTCCTCAAGGAAATGGAGGG - Intergenic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1188059278 X:25580980-25581002 AGCCCCCAGGAAGTTATGGAAGG + Intergenic
1194001094 X:88429429-88429451 AGCATCAATGAGGATATTGATGG - Intergenic
1199798115 X:151222326-151222348 AGCCTCCAGGAGGTTAGGCAAGG - Intergenic