ID: 1167743637

View in Genome Browser
Species Human (GRCh38)
Location 19:51339004-51339026
Sequence CTCCCCGAAGGCATCCGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 57}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167743637_1167743651 29 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743651 19:51339056-51339078 CCCCGCCGGGCCACGAGCAGCGG 0: 1
1: 0
2: 0
3: 8
4: 138
1167743637_1167743645 4 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743645 19:51339031-51339053 TGGAACTGCAGGGAGGCAGCAGG 0: 2
1: 0
2: 2
3: 64
4: 497
1167743637_1167743641 -6 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743641 19:51339021-51339043 GGGGAGACCCTGGAACTGCAGGG 0: 1
1: 0
2: 2
3: 25
4: 257
1167743637_1167743649 16 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG 0: 1
1: 0
2: 7
3: 57
4: 551
1167743637_1167743647 6 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743647 19:51339033-51339055 GAACTGCAGGGAGGCAGCAGGGG 0: 1
1: 0
2: 5
3: 80
4: 631
1167743637_1167743640 -7 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743640 19:51339020-51339042 CGGGGAGACCCTGGAACTGCAGG 0: 1
1: 0
2: 0
3: 25
4: 203
1167743637_1167743648 15 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743648 19:51339042-51339064 GGAGGCAGCAGGGGCCCCGCCGG 0: 1
1: 0
2: 3
3: 65
4: 610
1167743637_1167743642 -3 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743642 19:51339024-51339046 GAGACCCTGGAACTGCAGGGAGG 0: 1
1: 1
2: 1
3: 21
4: 289
1167743637_1167743646 5 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743646 19:51339032-51339054 GGAACTGCAGGGAGGCAGCAGGG 0: 1
1: 0
2: 10
3: 180
4: 1261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167743637 Original CRISPR CTCCCCGAAGGCATCCGCGC CGG (reversed) Exonic