ID: 1167743649

View in Genome Browser
Species Human (GRCh38)
Location 19:51339043-51339065
Sequence GAGGCAGCAGGGGCCCCGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 7, 3: 57, 4: 551}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167743639_1167743649 4 Left 1167743639 19:51339016-51339038 CCTTCGGGGAGACCCTGGAACTG 0: 1
1: 0
2: 0
3: 6
4: 114
Right 1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG 0: 1
1: 0
2: 7
3: 57
4: 551
1167743643_1167743649 -8 Left 1167743643 19:51339028-51339050 CCCTGGAACTGCAGGGAGGCAGC 0: 1
1: 0
2: 3
3: 28
4: 284
Right 1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG 0: 1
1: 0
2: 7
3: 57
4: 551
1167743637_1167743649 16 Left 1167743637 19:51339004-51339026 CCGGCGCGGATGCCTTCGGGGAG 0: 1
1: 0
2: 0
3: 11
4: 57
Right 1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG 0: 1
1: 0
2: 7
3: 57
4: 551
1167743636_1167743649 17 Left 1167743636 19:51339003-51339025 CCCGGCGCGGATGCCTTCGGGGA 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG 0: 1
1: 0
2: 7
3: 57
4: 551
1167743644_1167743649 -9 Left 1167743644 19:51339029-51339051 CCTGGAACTGCAGGGAGGCAGCA 0: 1
1: 0
2: 6
3: 66
4: 555
Right 1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG 0: 1
1: 0
2: 7
3: 57
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167743649 Original CRISPR GAGGCAGCAGGGGCCCCGCC GGG Exonic
900117092 1:1033542-1033564 GGGGGAGCAGGGGTCGCGCCGGG - Intronic
900165837 1:1243995-1244017 CCGGCTGCAGGGTCCCCGCCGGG - Exonic
900207348 1:1437232-1437254 GAAGCATCAGGTGCCCGGCCAGG + Exonic
900361031 1:2289234-2289256 GAGGCAGGAGGGCCACCTCCGGG - Intronic
900439079 1:2644397-2644419 GAGGCAGCCCGGGCCCGGCTGGG - Exonic
900559046 1:3294620-3294642 GAGGCAGCACGGGATCCGTCGGG - Intronic
900625018 1:3604034-3604056 GGGACAGCAGGGGCTCCACCAGG + Intronic
900645222 1:3705969-3705991 GAGGGTGCAGGGGCCTCGCCGGG - Intronic
900662014 1:3789498-3789520 GAGGCGGGCGGGGCCCCACCGGG + Intronic
900868045 1:5282788-5282810 GAGGCAGCAGGGACAGGGCCTGG + Intergenic
901324419 1:8358373-8358395 GCCGCAGCTGGGGGCCCGCCAGG + Exonic
901450527 1:9333896-9333918 GAGGCAGGTGGGGCCTGGCCAGG + Intronic
901796803 1:11684194-11684216 GAGTCAGCATGGGCCCATCCGGG + Intronic
901822155 1:11837164-11837186 CGGGCAGTGGGGGCCCCGCCAGG - Intronic
902146133 1:14400725-14400747 AATGCAGCAGGGGCCGGGCCTGG - Intergenic
902439170 1:16418057-16418079 CAGGGAGCAGGGGCCCTCCCCGG + Intronic
902512123 1:16972279-16972301 GAGGCAGCAGGGAACCCGGAGGG - Intronic
902623343 1:17662999-17663021 GAGGAAGCTGGGTCCCAGCCTGG - Intronic
903212764 1:21828067-21828089 GAGGCAGCGGGTGCCCTGGCAGG + Exonic
903421475 1:23220413-23220435 GAGGTAGCAGGGGGCCCACGGGG + Intergenic
903646775 1:24900862-24900884 GAGGCAGCTGGGGGTCCGCGGGG + Exonic
904208233 1:28868924-28868946 GACCCAGCAGGTGCCCAGCCTGG - Intergenic
904285038 1:29448624-29448646 GAGGCAGCAGGGGGTCAGCAAGG + Intergenic
904782833 1:32963972-32963994 GGGGCAGCAGGGACCCCGCGTGG - Intronic
906116133 1:43358701-43358723 GAGGCAGCGCAGGCCCCACCCGG + Intergenic
906126976 1:43432729-43432751 GAGTCAGCCTGGGCCCAGCCGGG + Exonic
906305271 1:44714293-44714315 GAGGGAGCAGGGGCCAGGCCTGG + Intronic
906318019 1:44800529-44800551 GAGGCGGCCCGGGCCCGGCCGGG - Exonic
906518028 1:46450937-46450959 GAGGCAGCAGCTGCCCTGTCTGG - Intergenic
906686950 1:47769057-47769079 GAGGCCTCAGTGTCCCCGCCTGG - Intronic
906696516 1:47827094-47827116 GATGCAGCACGGGCCTCGCTGGG + Intronic
907405597 1:54251733-54251755 GAGGGAGGAGGAGCCCCTCCTGG + Intronic
908818445 1:68057757-68057779 GGGGGAGCAGGGGCCCCTGCTGG - Intergenic
912598698 1:110904796-110904818 AAGGCAGCAGGGGCCAATCCTGG + Intergenic
912879194 1:113391188-113391210 GACGCAGCAGGTGCCCCCGCCGG - Exonic
913090051 1:115470461-115470483 GAGGAAGGAGGGGCCGAGCCAGG - Intergenic
915082538 1:153361870-153361892 GAGGCAGCTAGGGCCAGGCCTGG - Intergenic
916193098 1:162198024-162198046 GAGGCGTCATGGGCCCGGCCTGG + Intronic
916588232 1:166166425-166166447 GGGGCAGCGGGGACCCCGCGCGG - Exonic
916792601 1:168136970-168136992 GGGGCCGGAGGGGCCCGGCCGGG - Intronic
917930675 1:179820639-179820661 GAGGCAGCAGGGCCCCCCACAGG + Intergenic
917931088 1:179823399-179823421 GAGGCAGCAGGGCCCCCCACAGG + Intergenic
918282724 1:183022866-183022888 GCGGCAAGAGGGTCCCCGCCCGG - Intergenic
919878955 1:201889587-201889609 GAGGCAGCAGAAGCACTGCCTGG + Exonic
920336664 1:205249564-205249586 GAGGCTGAAGGGGCCCAGACGGG + Intronic
920528354 1:206684957-206684979 GGGGCGGCGGGGGCCCGGCCGGG - Intronic
921039534 1:211416659-211416681 GAGGCAGCAGCGGCGGCGCCGGG + Intergenic
921625572 1:217374513-217374535 GAGTGAGCAGGGGCCAGGCCTGG + Intergenic
922514547 1:226197245-226197267 GAGGTCGCTGAGGCCCCGCCTGG + Intergenic
922604587 1:226881685-226881707 GAGGCAGCAGCGGCCTTGCCTGG - Intronic
923429148 1:233904639-233904661 TGGGCAGCAGCGCCCCCGCCTGG + Intergenic
923761278 1:236847214-236847236 GAGGAAGCAGAGGCCCATCCTGG - Intronic
924723729 1:246647336-246647358 GAGACAGCAGGGAGCCCGTCTGG + Exonic
1063776660 10:9273135-9273157 GGGGCAGCAGCTGCCCCGTCCGG - Intergenic
1063776748 10:9273334-9273356 GGGGCAGCAGCCGCCCCGTCCGG - Intergenic
1065149799 10:22811156-22811178 GAGAAAGCAGGGGCCCAGGCTGG - Intergenic
1066456387 10:35575807-35575829 CAGGCAGCACGGTTCCCGCCTGG + Intergenic
1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG + Intergenic
1067596976 10:47565821-47565843 GAGGCAGCAAGGGCTGAGCCCGG + Intergenic
1067685331 10:48463474-48463496 CAGGCACCAGGGGCACTGCCAGG - Intronic
1068388465 10:56361155-56361177 GTGGCAGCTGGGGCCGGGCCTGG - Intronic
1068654693 10:59562785-59562807 GAAGCAGCAGTGGCCCAGACTGG + Intergenic
1069625907 10:69867533-69867555 GAGGCAGAAGGGCCACCGGCAGG + Intronic
1069663574 10:70139807-70139829 GAGGCAGCCTGGGCCCCTGCAGG + Exonic
1069722624 10:70559521-70559543 GAGGTGGCAGGGGGCCAGCCAGG + Intronic
1069947714 10:71999256-71999278 GAGGCGGCAGGGGAGCCCCCAGG - Intronic
1070653388 10:78254083-78254105 GGGCCAGCATGGGCCCCTCCAGG - Intergenic
1071602438 10:86964884-86964906 GGGGCAGCAGGGACCCCTCTGGG - Intronic
1072654323 10:97319717-97319739 GCAGCAGCAGCGGCACCGCCGGG - Exonic
1072656561 10:97334287-97334309 GCAGCAGCAGCGGCACCGCCGGG + Exonic
1072682271 10:97516130-97516152 GTGTCAGCAGGAGCCCCTCCAGG + Intronic
1072695817 10:97601999-97602021 GTGGCAGCGGGGGCGCGGCCTGG + Intronic
1072784020 10:98268301-98268323 GAGTCCGCGGGCGCCCCGCCCGG + Intergenic
1073036448 10:100567234-100567256 TATGCAGAAGGGGCCCAGCCAGG - Intergenic
1073046554 10:100642531-100642553 CCGGCAGCAGTGGCCCCACCTGG + Intergenic
1073150863 10:101310576-101310598 GAGGGAGCCGGGGCAGCGCCTGG - Intergenic
1073288821 10:102403333-102403355 GAGGCAGCACTGGCCCAGGCCGG - Exonic
1075037424 10:119080835-119080857 GCGGCAGCAGGGCCGCCGCGGGG - Intergenic
1076724951 10:132408925-132408947 GCCTCAGCAGGGGCCGCGCCAGG + Intronic
1076876580 10:133219246-133219268 GTGGCAACAGAGGCCCTGCCGGG - Intronic
1076948182 10:133665614-133665636 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076949171 10:133668924-133668946 GCGGCTGCAGGGGCCCGGGCGGG - Intronic
1076950155 10:133672223-133672245 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076951140 10:133675522-133675544 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076952130 10:133678832-133678854 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076953118 10:133682142-133682164 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076954102 10:133685441-133685463 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076955086 10:133741793-133741815 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076956076 10:133745103-133745125 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076957065 10:133748413-133748435 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076958053 10:133751722-133751744 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076959037 10:133755021-133755043 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076960026 10:133758331-133758353 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076961010 10:133761630-133761652 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1077077123 11:706861-706883 GGGGCTGCAGAGGCCCTGCCAGG + Intronic
1077244909 11:1531993-1532015 GAGGCAACAGGAGCCACCCCTGG - Intergenic
1077498302 11:2897303-2897325 GAGACAGCATGGGCACCACCAGG + Intronic
1079630317 11:22666828-22666850 GAAGCTGCAGGAGCCCAGCCCGG + Exonic
1081615314 11:44587357-44587379 GTGGCCGGCGGGGCCCCGCCAGG - Intronic
1081683156 11:45022929-45022951 GAGGCTACAGGGGCCCAGGCAGG + Intergenic
1081808472 11:45902509-45902531 GGGGCAGCAGGGGGACCACCCGG - Exonic
1082803415 11:57431088-57431110 GAGGCAGCAGAGGATCAGCCTGG + Intergenic
1082816870 11:57514962-57514984 GAGGCTGCAGCGGCCGCGGCGGG - Intronic
1083593465 11:63908317-63908339 GAGCCAGCACTGGCCCTGCCCGG + Intronic
1083714935 11:64569727-64569749 GAGGCAGCAGGGGCAGGGCTTGG - Exonic
1083728872 11:64642731-64642753 GCGGCGGCAGGGGCCCAGCCAGG + Intronic
1084039416 11:66532693-66532715 GAGGCAGAGGGTGCCCCGCAGGG + Exonic
1084087480 11:66861223-66861245 GAGGCTGCAGGGGCTGGGCCAGG - Intronic
1084172162 11:67405900-67405922 CAGGCAGCAGGGGCTCCTGCAGG + Exonic
1084372640 11:68754075-68754097 GAGACAGCAGTGACCCCACCAGG - Intergenic
1084432871 11:69121471-69121493 GAGGCAGGAGGTGTCCTGCCTGG + Intergenic
1084611140 11:70203715-70203737 GCGGCGGCCGGGGCCGCGCCTGG + Exonic
1084640728 11:70424191-70424213 GAGGTAGCAGGGGCCTTGCAAGG + Intronic
1086863005 11:91947415-91947437 GAGTCAGGAGGGGCCACCCCTGG + Intergenic
1087743393 11:101915070-101915092 GAGGCAGCGGCGACCTCGCCGGG - Exonic
1089457703 11:118634949-118634971 GAGGCACCTGGAGGCCCGCCAGG + Intronic
1089730071 11:120513747-120513769 GAGGCAGCACTGGTCCCTCCGGG + Intronic
1090428591 11:126627667-126627689 GAGGCAGCAGGCCCCACGCAGGG - Intronic
1090709602 11:129373489-129373511 GCGGAAGCAGGGGGCGCGCCTGG + Intergenic
1091372584 11:135073247-135073269 GAGGCAGCAGAGAGCCCACCAGG + Intergenic
1091568274 12:1663004-1663026 GAGGCAGCCGGGGGTCCGCTGGG + Intergenic
1092222418 12:6724106-6724128 GACGGAGCGGCGGCCCCGCCCGG + Exonic
1094587271 12:31789052-31789074 GAGGAAACAGGGGCCTGGCCGGG - Intergenic
1096533846 12:52258458-52258480 GATGCAGCAGCGGCCGGGCCGGG + Intronic
1096540022 12:52301975-52301997 GATGCAGCAGCGGCCGGGCCGGG - Exonic
1096887340 12:54731032-54731054 GTGGCAGCAGGTGTGCCGCCAGG + Intergenic
1097191965 12:57223794-57223816 GAGGCAGGAGCGGCCGGGCCAGG - Intronic
1098288545 12:68933280-68933302 AAGGCGGCTGAGGCCCCGCCCGG - Intronic
1098602235 12:72345811-72345833 GAGGAAACAGGGTCCCCACCTGG - Intronic
1100854867 12:98749819-98749841 GAGGTGGCAGTGGCCCCGACTGG + Intronic
1103283963 12:119784870-119784892 GAGCCAGCAGCGGCCCCGGGCGG + Intronic
1103325327 12:120116557-120116579 GAGGCGGCGCGGGCCCTGCCGGG - Intronic
1103404666 12:120666899-120666921 GAGGCCGCGAGGGCCCCTCCAGG + Exonic
1103556708 12:121770983-121771005 GAGGCTGGAGGGGCCCAGCGAGG - Intronic
1103722483 12:122982154-122982176 CAGGCACCAGGAACCCCGCCCGG - Intronic
1103825190 12:123732313-123732335 GCAGGAGCAGGGGCCCAGCCAGG - Intronic
1104021247 12:124993823-124993845 GCAGCAGCAGGAGCCCGGCCCGG - Exonic
1104567962 12:129902633-129902655 GGAGCAGCAGCGGCCCCGCAGGG - Intronic
1104569052 12:129909200-129909222 GAGGATGCAGGGGCCTCGTCAGG + Intergenic
1104987836 12:132607033-132607055 TGGGCAGCAAGGGCCCCTCCAGG - Intronic
1105512442 13:21061629-21061651 GGGGCCGCAGGCGCCCCGCCCGG - Intergenic
1105827731 13:24137310-24137332 GAGACAGCAAAGGCCCAGCCAGG - Intronic
1110448614 13:75616886-75616908 GAGGCACCAGGGACCAAGCCTGG - Intergenic
1112508442 13:99989256-99989278 GAGGCAGCTGGAGCCCCCTCGGG + Intergenic
1113292181 13:108919245-108919267 GGGGCAGGAAGGGCCCAGCCAGG - Intronic
1113782399 13:112984107-112984129 GAGGCAGCAGCACCCTCGCCGGG + Intronic
1113961354 13:114128019-114128041 GAAACAGCAGGGGCTCCGGCAGG - Intronic
1114551574 14:23535406-23535428 GAGGCTGCAGGGACCCCAGCTGG + Intronic
1118888993 14:69891607-69891629 AAGGCAGCAGCAGCCCCTCCTGG - Intronic
1119730341 14:76947291-76947313 GTGGCAGGCGAGGCCCCGCCGGG + Intergenic
1120995978 14:90419114-90419136 GGGGCAGCAGGGGGCCCTCAGGG + Intergenic
1121671468 14:95713898-95713920 GAGGCAGCAGGGGCAGCCCCTGG - Intronic
1122023809 14:98859991-98860013 GGGGCAGCAGGGGCCAGGCTTGG + Intergenic
1122044401 14:99012854-99012876 GAGGCAGCAATGGCCCTGACTGG + Intergenic
1122123464 14:99566806-99566828 CAGGCAGCAGGGGCCTCTCAGGG + Intronic
1122123711 14:99568097-99568119 GAGGCAGGAGGGGCTCAGGCTGG + Intronic
1122261789 14:100527728-100527750 GAGGGAGCAGGTGCTCAGCCTGG + Intronic
1122504939 14:102226496-102226518 GGGGTGGCAGAGGCCCCGCCGGG + Intronic
1122657773 14:103273665-103273687 GGCGCAGCTGGGTCCCCGCCAGG - Intergenic
1122832408 14:104405806-104405828 GAGGCTCCAGGGAGCCCGCCAGG + Intergenic
1122836615 14:104433853-104433875 GAGGTAGCAGGGGCCACCTCAGG - Intergenic
1122937393 14:104966510-104966532 GGAGCAGCAGGGGCCCTGTCAGG - Intronic
1122984360 14:105205448-105205470 GAGGCAGCAGCGGGCCCCACGGG - Intergenic
1123038605 14:105481378-105481400 GAGCCAGCCCAGGCCCCGCCAGG - Intergenic
1123113626 14:105884084-105884106 GAGGCTGCAGAGGCCTCTCCAGG - Intergenic
1123115851 14:105893723-105893745 GAGGCTGCAGAGGCCTCTCCAGG - Intergenic
1123117876 14:105902833-105902855 GAGGCTGCAGAGGCCTCTCCAGG - Intergenic
1123120093 14:105912438-105912460 GAGGCTGCAGAGGCCTCTCCAGG - Intergenic
1123120626 14:105914763-105914785 GAGGCTGCAGGGGCTCATCCAGG - Intergenic
1123134123 14:106011818-106011840 GAGCCAGCAGGGGGCGCGCGGGG - Intergenic
1202849994 14_GL000225v1_random:10150-10172 GAGGCTGCAGGGGCACGGGCGGG - Intergenic
1202855046 14_GL000225v1_random:44565-44587 GAGGCTGCAGGGGCACGGGCGGG - Intergenic
1202857470 14_GL000225v1_random:59855-59877 GAGGCTGCAGGGGCACGGGCAGG - Intergenic
1123402831 15:20004024-20004046 GAGGCTGCAGAGGCCTCTCCAGG - Intergenic
1123512168 15:21010678-21010700 GAGGCTGCAGAGGCCTCTCCAGG - Intergenic
1123774526 15:23565816-23565838 GAGGCAGCCGGGGCCCAGGCAGG + Exonic
1124113633 15:26817942-26817964 GAGGCAGCAGCTGACCTGCCTGG - Intronic
1127770120 15:62224248-62224270 GCGGCGCCAGGGGCCCCGCTGGG + Intergenic
1127960531 15:63887176-63887198 GAGGGAGCAGGGGCCGGGCATGG - Intergenic
1127996065 15:64153703-64153725 GGGGCAGCAGGGGCCAAGCGCGG - Intronic
1128137691 15:65276085-65276107 GATGCAGCAGGGACCCTGTCTGG - Intronic
1128944988 15:71813854-71813876 GAGCCACCAGGGGCTCCGGCTGG - Intronic
1129885344 15:79033089-79033111 TAGGCAGAAAGGGCCCCACCTGG - Intronic
1130093231 15:80838290-80838312 GGGCCAGCAGGGTCCCTGCCAGG - Intronic
1132111425 15:99104957-99104979 GCGGCCGCAGAGGCCGCGCCGGG + Intronic
1132344758 15:101101448-101101470 GAGGCTGCGGGGTCCCAGCCTGG - Intergenic
1132346672 15:101112882-101112904 GAGGAAGCAGAGGCCCTGGCTGG - Intergenic
1132584681 16:700964-700986 GAGGCGGCGGGGGCGGCGCCAGG + Intronic
1132588278 16:715515-715537 GAGGGAGCGGGGGCTGCGCCGGG + Intronic
1132648785 16:1011100-1011122 CAGGCAGGAGCAGCCCCGCCCGG + Intergenic
1132779422 16:1614471-1614493 GGGGCGGCAGGGGCCGCGGCGGG + Intronic
1132808390 16:1786351-1786373 GGGGCTGCAGGGGACCTGCCTGG + Intronic
1132863978 16:2084731-2084753 GAGGTGTCAGGAGCCCCGCCCGG - Intronic
1132937374 16:2488008-2488030 GGGGCAGGAGGGGCCCCAGCGGG - Intronic
1132950902 16:2562042-2562064 GAGGCAGCCGAGGCAGCGCCAGG + Intronic
1132963447 16:2638128-2638150 GAGGCAGCCGAGGCAGCGCCAGG - Intergenic
1133041928 16:3065424-3065446 GAGGGAGCAGGGGCCCAGCCAGG + Exonic
1133270798 16:4610024-4610046 GAGGCAGTGGGGGCCCCTCCAGG - Intronic
1134004483 16:10809119-10809141 GGGGCATCAGGAGCCCTGCCAGG + Intronic
1134006388 16:10821262-10821284 CAGGCTGCTGGGGCCCCGCTGGG - Intergenic
1134243363 16:12522054-12522076 GTGCCAGCAGGGGCCCCTCGGGG - Intronic
1134521313 16:14920321-14920343 GAGGCATCAGGGGTCCCTACAGG - Intronic
1134597774 16:15509669-15509691 GAAGCAGCAGGGGTCCCAGCGGG - Intronic
1134708988 16:16318972-16318994 GAGGCATCAGGGGTCCCTACAGG - Intergenic
1134716198 16:16359006-16359028 GAGGCATCAGGGGTCCCTGCAGG - Intergenic
1134950617 16:18349673-18349695 GAGGCATCAGGGGTCCCTACAGG + Intergenic
1134958555 16:18393153-18393175 GAGGCATCAGGGGTCCCTGCAGG + Intergenic
1135413350 16:22251119-22251141 GAGGCAACAGGGGGCCTACCTGG - Intronic
1135485922 16:22864556-22864578 GTGGCTGCAGGGGCCCCTCCTGG + Intronic
1135590331 16:23700662-23700684 GAAGCAGCAGGAGACCCCCCTGG - Exonic
1135698249 16:24609688-24609710 GAGTCAGGTGGGGCCCCGACTGG - Intergenic
1136227601 16:28869425-28869447 CTGACAGCAGGGGCCCCGCATGG - Intronic
1137017728 16:35393676-35393698 GAGGCACCAGGGGCCCAGGAAGG + Intergenic
1137237199 16:46625879-46625901 CAGGAAGCAGGTTCCCCGCCTGG + Intergenic
1137329638 16:47479578-47479600 CAGGCAGCAAGGGCCTCACCTGG - Intronic
1137601514 16:49759537-49759559 GAGGCTGCTGTGGTCCCGCCAGG - Intronic
1138116400 16:54364110-54364132 GAGACAGCAAGGTCCCCACCAGG - Intergenic
1139359393 16:66388131-66388153 GTGGCAGTGGGGGCCCAGCCAGG - Intronic
1139402850 16:66696310-66696332 CGGGCACCTGGGGCCCCGCCCGG + Intronic
1139747149 16:69083726-69083748 GAGGCAGCAGGGCCACCTGCTGG - Exonic
1139974782 16:70800937-70800959 GCGGCTGCCGGGGCCGCGCCGGG + Exonic
1140212425 16:72981117-72981139 GAGATAGCTGGGGCCCGGCCTGG - Intronic
1141132939 16:81447335-81447357 GAGGGAGAAGGGGCTCCTCCTGG - Intronic
1141665557 16:85463508-85463530 CAGGCACGAGGGGCCCTGCCAGG - Intergenic
1142027932 16:87824386-87824408 GAGGCAACAGTGGCTCTGCCTGG - Intergenic
1142126089 16:88411387-88411409 GGGGCAGCAGGGGCAAGGCCAGG + Intergenic
1142141421 16:88474370-88474392 GATGCAGCAGCTGCCCGGCCAGG + Intronic
1142286026 16:89171888-89171910 GAGGCAGCGGGGACCCCCGCAGG - Intronic
1142472392 17:171272-171294 GCGGCACCAGGGGCCGGGCCAGG + Intronic
1142718718 17:1762546-1762568 GAGGGAGCAGGGGCCAGGGCTGG - Intronic
1143036771 17:4004044-4004066 AAGGCAGCAGGCGCACTGCCTGG + Intergenic
1143165176 17:4893957-4893979 GAGGAAGGTGGGGCCCCTCCAGG - Intronic
1143205914 17:5139179-5139201 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1143323160 17:6080942-6080964 GAGCCAGCGGGGGCCGGGCCGGG - Exonic
1143543454 17:7582875-7582897 GGGGCTGCTGGGGCCCTGCCAGG - Intergenic
1143750126 17:9021716-9021738 GGGGCAGCGGCGGCCGCGCCGGG + Intronic
1144816653 17:18039741-18039763 GAGGCAGCGGAGGCACCGGCCGG - Exonic
1144889064 17:18483574-18483596 GAGGCAGCGGAGGCCACACCAGG - Intronic
1145143145 17:20460722-20460744 GAGGCAGCGGAGGCCACACCAGG + Intronic
1145208657 17:20997512-20997534 GAGGCCTCAGGGGCCTCTCCAGG - Intergenic
1145209922 17:21005208-21005230 GAAGAACCAGGGGCCACGCCAGG - Intronic
1145815665 17:27793514-27793536 GAGAGAGATGGGGCCCCGCCCGG + Intronic
1146354879 17:32125527-32125549 GAAGCAGCAGGGTCCCAGTCTGG - Intergenic
1146400396 17:32496571-32496593 AGGGCTGCAGGGGCCCCACCTGG - Intronic
1146484792 17:33234354-33234376 GACTCTGCAGGGGCCCAGCCAGG - Intronic
1146492385 17:33292276-33292298 GAGGCGGCAGCGGCGGCGCCGGG - Exonic
1146691140 17:34876951-34876973 GAGCCTGCAGGGACCCAGCCAGG - Intergenic
1146691313 17:34878057-34878079 GAGGCAGCTGGAGCCCCTCAAGG + Intergenic
1146827261 17:36033508-36033530 GAGGCAGTAGAGGGCCAGCCTGG - Intergenic
1146842696 17:36166617-36166639 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146855009 17:36254576-36254598 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146865611 17:36333800-36333822 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1146870909 17:36378468-36378490 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146878267 17:36429550-36429572 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1146882216 17:36450696-36450718 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1147068480 17:37934412-37934434 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147073793 17:37979092-37979114 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147080003 17:38013949-38013971 CAGGCAGGTGGGGCCCAGCCCGG + Intronic
1147085314 17:38058630-38058652 CAGGCAGGTGGGGCCCAGCCCGG - Intronic
1147095952 17:38137909-38137931 CAGGCAGGTGGGGCCCAGCCCGG + Intergenic
1147101261 17:38182596-38182618 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1147240015 17:39084704-39084726 GCGACAGCTGGGGCCCAGCCTGG + Intronic
1147319865 17:39639683-39639705 GAGCCAGCAGGGACCATGCCTGG + Intronic
1147423116 17:40332256-40332278 GAGGGAGCCGGGGCCTGGCCTGG + Intronic
1147503864 17:40994056-40994078 GAGGCTGCAGTGTCCCCACCGGG - Exonic
1148199344 17:45739760-45739782 GAGGCAGCAGGACCCCCTCCTGG - Intergenic
1148700396 17:49583323-49583345 GAGGCACCATTAGCCCCGCCAGG + Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149845858 17:60009102-60009124 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1150084209 17:62265682-62265704 CAGGCAGGTGGGGCCCAGCCCGG - Intergenic
1150119109 17:62584536-62584558 GAGGCAGTAGAGGCCATGCCCGG - Intronic
1150213710 17:63455635-63455657 GAGGAGGCAGAGGCCACGCCAGG + Intergenic
1151306087 17:73263423-73263445 GAGGCATGAGGGGCCCAGCAGGG + Intergenic
1151368943 17:73635318-73635340 GTGGCAGCAGGGGCCCAGACGGG - Intronic
1151679208 17:75614887-75614909 GGGGCAGCAGAGGCCCCGGGGGG - Intergenic
1152071722 17:78137501-78137523 GTGGCAGCAGTGGCGCCCCCTGG - Intronic
1152158335 17:78649994-78650016 GAGGTAGCAAGGGGCCCCCCTGG + Intergenic
1152227049 17:79097456-79097478 GAGGCACAAGGGGACCCACCTGG + Intronic
1152246136 17:79185470-79185492 GAGGCAGCAAGGGCCACTCCAGG - Intronic
1152275405 17:79353792-79353814 GAGGCACGAGGGGCCCCCACTGG + Intronic
1152430977 17:80248194-80248216 GAGACACCAGGGCCCCGGCCAGG - Exonic
1152538379 17:80963125-80963147 AAGGCAGCAGGGGTCCTGCCTGG + Intronic
1152561104 17:81079195-81079217 TGGGGAGCAGGGGCCCAGCCGGG + Intronic
1152663072 17:81551954-81551976 CAGGCAGTAGAGGCCCCTCCGGG + Exonic
1152758701 17:82097696-82097718 GGGGGCGCAGGGGCCGCGCCGGG - Intronic
1152890538 17:82879226-82879248 GAGGCAGCTGAGGCCAAGCCCGG - Intronic
1152965642 18:111857-111879 GAGGCCGCAGGGGCCCGGGCGGG + Intergenic
1153515135 18:5895352-5895374 GCGGCCGCAGGGGCCCGCCCGGG - Exonic
1155282297 18:24251729-24251751 AAGGCAGCAGGGGCCGATCCTGG + Intronic
1155300749 18:24426786-24426808 GAGGCAGGTGAGGCCCCGGCGGG + Exonic
1156499327 18:37547244-37547266 GAGCCAACAGGAGCCCCCCCAGG + Intronic
1157489591 18:48113503-48113525 GGGGCAGGAGGTGCCCCGGCTGG + Intronic
1157517033 18:48318403-48318425 AAGGCAGAAGGGGCCTCTCCAGG - Intronic
1157546273 18:48548850-48548872 TGGGCAGCAGGGACCCTGCCAGG - Intronic
1157610077 18:48950539-48950561 GCAGCAGCAGGGGCCCGGGCAGG + Exonic
1157617923 18:48998367-48998389 CAGGCACCAAGGGTCCCGCCTGG - Intergenic
1157685588 18:49640246-49640268 GAGTCAGCAGGGGACCCACAGGG - Intergenic
1158532744 18:58278348-58278370 GAGGCAGGAGGGGCAGGGCCTGG - Intronic
1159609621 18:70511152-70511174 GAGGCAGCGTGGGCCCCACAGGG - Intergenic
1160048315 18:75408022-75408044 GTGGCAGCAGTGGCCGCACCAGG + Exonic
1160317989 18:77866009-77866031 GAGGAAGCCGAGGCCCCGCAGGG + Intergenic
1160371325 18:78374034-78374056 GAGGCAGCAGGGGCTGCACTTGG + Intergenic
1160419704 18:78735615-78735637 GAGGGAGCAGGGGCCCTGGAAGG - Intergenic
1160540115 18:79616744-79616766 GAGGCCGCCGGGGCCCGGGCTGG + Intergenic
1160792618 19:929564-929586 GCGGCAGCAGCGGGCGCGCCAGG + Exonic
1160792642 19:929634-929656 GGGGCAGCCCGGGCCCGGCCGGG - Exonic
1160871722 19:1280816-1280838 GGTGCAGCACGGGCCCCGACAGG - Intergenic
1160876650 19:1299693-1299715 GAGGGAGCAGAGGGCCTGCCTGG + Intronic
1160893204 19:1390345-1390367 CATGCAGCAGGGCCCCTGCCAGG + Intronic
1160909725 19:1468984-1469006 CAGGCTGCTGGGGCCCTGCCCGG + Exonic
1161015343 19:1980326-1980348 CAGACTGCAGGGGCCGCGCCTGG + Exonic
1161016945 19:1987840-1987862 CAGGCAGCAGGGGCCATGGCTGG - Intronic
1161026284 19:2038814-2038836 GAGACAGCAGGAGCCCCGCCTGG - Exonic
1161077039 19:2290855-2290877 CAGCCAGCAGGGCCCCGGCCAGG + Exonic
1161103045 19:2430738-2430760 GAGGCTGGAGGAGACCCGCCAGG + Exonic
1161203289 19:3028022-3028044 GAGGAAGCGGGGGCTCTGCCTGG + Intronic
1161238229 19:3208377-3208399 GGGGAGGCAGGGGCCCTGCCAGG - Exonic
1161265028 19:3359987-3360009 GAGGGGGCGGGGGCCCGGCCTGG - Intronic
1161273886 19:3404806-3404828 GAGGCCGCAGGGCCCCTGCTCGG - Intronic
1161582542 19:5088633-5088655 GAGGCTGCAGGGGACAGGCCAGG + Intronic
1161666174 19:5578345-5578367 GCGGCAGGAGGGGCCCAACCGGG + Intergenic
1162124945 19:8494377-8494399 GAAGCAGAAGGGGCCCCACCAGG + Intronic
1162937157 19:13986955-13986977 GGGGCAGCAGGGGCCCCTCCAGG - Intronic
1163000562 19:14363983-14364005 GAGGCAGGAGGGGCCACGAGCGG - Intergenic
1163325885 19:16603040-16603062 TAGGCAGCAGGGGCTCTGCCAGG - Intronic
1163554174 19:17983208-17983230 GAGGCAGGAGGGGCTCCGCCAGG + Intronic
1163567136 19:18058522-18058544 GAGGCAGGGCGGGCCCGGCCGGG + Intergenic
1163638178 19:18447179-18447201 GAGGCAGCAAGGGCCTGGCCTGG - Intronic
1164476572 19:28580018-28580040 GAGGCAGCATGGGCACCAACTGG + Intergenic
1164639239 19:29812316-29812338 GAGGCAGCCCGGGCCCCGGGAGG + Intronic
1164810247 19:31149501-31149523 GAGGCGGGAGGGGCACAGCCAGG + Intergenic
1164879102 19:31715688-31715710 CAGCCAGGAGGAGCCCCGCCAGG + Intergenic
1165311426 19:35031087-35031109 GCGGCTGCAGGCGCCCAGCCGGG + Intronic
1165408031 19:35642572-35642594 GGGTCAGCAGAGGCCCCACCTGG - Intronic
1165743600 19:38217625-38217647 GAGGCGGCAGGGGCCCGGAGGGG - Intronic
1166700549 19:44879309-44879331 GGGACAGCAGGGGCTCAGCCAGG + Intronic
1166738877 19:45102349-45102371 GAGGCAGCACGGGAGCCCCCTGG + Intronic
1167110463 19:47457622-47457644 GAGGGAGAAGGCGGCCCGCCCGG - Intronic
1167374582 19:49104000-49104022 CCTGCTGCAGGGGCCCCGCCAGG + Intronic
1167630371 19:50622576-50622598 GAGGGAGGAGGGGCTGCGCCTGG - Intronic
1167676495 19:50889667-50889689 GAGGTAGGAGGGGCCCCAGCTGG - Intergenic
1167743649 19:51339043-51339065 GAGGCAGCAGGGGCCCCGCCGGG + Exonic
1168144851 19:54415370-54415392 GGGGCAGCACCGTCCCCGCCCGG + Intronic
1168659456 19:58154822-58154844 CAGGCAGCGGAGGCCCTGCCCGG + Intronic
925187435 2:1858865-1858887 GAGGCAGCAGAGACTCCACCCGG - Intronic
925335705 2:3097900-3097922 GAGCAGGCAGGTGCCCCGCCGGG + Intergenic
926150728 2:10424364-10424386 GCGGCAGCAGGTGCCCTGCTAGG - Intronic
926268299 2:11345034-11345056 GAGTCAGCGGGGGCCGCGGCGGG - Intronic
927076966 2:19588480-19588502 GAGGCAGCCATGGCCCAGCCTGG + Intergenic
927714044 2:25341429-25341451 GCTGCCGCAGGGGCCCCGGCCGG - Intronic
927836758 2:26405060-26405082 GAGGCAGCAGGGTCCCCACAAGG - Intronic
928126704 2:28621306-28621328 GAGCCAGCAGGGACAGCGCCCGG - Intronic
930089270 2:47520149-47520171 GAGGCTGCAGGAGCCCTGCTGGG - Exonic
931652159 2:64478333-64478355 GGGGCAGCAGGTGGCCCGCGAGG - Intergenic
931787569 2:65633979-65634001 GAGGCAGCAGGTGCCATGTCTGG - Intergenic
933876219 2:86623699-86623721 GAGGCAGCCGGGTAGCCGCCTGG - Exonic
934502978 2:94873681-94873703 GAGCCAGCAGGGGCTGCCCCAGG + Intronic
934647330 2:96066572-96066594 GAGGCAGCTGAGGCCCCGTGAGG - Intergenic
934710909 2:96513347-96513369 GAGGCAGCAGCAGCCCAGTCAGG - Intergenic
934840702 2:97622392-97622414 GAGGCAGCTGAGGCCCCGTGAGG - Intergenic
935681171 2:105638463-105638485 GTGGCTGGAGGGGCCCCTCCAGG + Intergenic
935789782 2:106580489-106580511 TAGGCAGCTGGGGCCCCAACCGG - Intergenic
936069259 2:109354300-109354322 GAGGCTGAAGGGGGCCCGGCAGG + Intronic
936090655 2:109499496-109499518 GGGGGTGCAGGGGCCCAGCCAGG + Intronic
937241507 2:120465288-120465310 GAGGCAGTGGGGGCAGCGCCTGG - Intergenic
937346929 2:121131955-121131977 AAGGCAGCAGGGAGCCGGCCAGG + Intergenic
937446443 2:121962696-121962718 GTGGCAGCCAGGGCCCCTCCTGG + Intergenic
937912254 2:127081417-127081439 GGGGCTGCTGGGGCCCAGCCGGG - Intronic
937999220 2:127719426-127719448 AAGTCAGCAGGGGCCGCCCCAGG - Exonic
938125731 2:128669965-128669987 GAGGCAGCCGGGGGCCAGGCTGG + Intergenic
938289492 2:130141858-130141880 CAGGCAGGAGGGGCCTCCCCGGG - Intronic
938368817 2:130756212-130756234 GCGGCTCCAGGGGCCCCGCGGGG - Intronic
938467038 2:131531080-131531102 CAGGCAGGAGGGGCCTCCCCGGG + Intronic
942276799 2:174328879-174328901 GAGGCAGCTGGGCCCGCTCCGGG + Intergenic
942564236 2:177250781-177250803 GTAGCAGCAGAGGCCCCACCTGG - Intronic
943369971 2:187003459-187003481 GAGAGAGAAGCGGCCCCGCCCGG - Intergenic
946453273 2:219799456-219799478 GAGGCTGGAGGGGCTCCCCCTGG + Intergenic
947163193 2:227235075-227235097 GAGGCAGCAGGGCCTCCGAAAGG - Intronic
947542855 2:230990690-230990712 GAGGCGCCAGGGGCTCCTCCTGG + Intergenic
947752949 2:232542188-232542210 GAGGCTGCAGGGCCCTCACCTGG - Intronic
947938428 2:234027009-234027031 AAGGAAGAAGGGGGCCCGCCCGG + Intergenic
948386599 2:237584651-237584673 GAGGCAGCAGGTGTCAGGCCAGG - Intronic
948667411 2:239545369-239545391 GAGGCAGCTGTGGGCCCGCCAGG - Intergenic
948824098 2:240566101-240566123 AGGGCAGCAGGGCCCCGGCCAGG + Intronic
948834471 2:240619574-240619596 GGGGCAGCAGGATCCCGGCCTGG - Intronic
1170370322 20:15640871-15640893 GAGGCAGCAGGGGCCCTTGTGGG - Intronic
1172502845 20:35439184-35439206 GGGGCAGCAGCGGCCCCTACAGG + Intronic
1172775545 20:37404626-37404648 GAGACAGCAGGGGCCACCCAAGG - Exonic
1172803318 20:37593615-37593637 GAGGCAGCAGGAGCCCCATCAGG + Intergenic
1173567327 20:44051350-44051372 GACCCAGCAGGGGCCCGGGCCGG - Exonic
1173603338 20:44311306-44311328 GAGGCAGCAGCGGCCACGAGGGG - Intergenic
1173834808 20:46118285-46118307 GAGTCAGCAGAGGCCTCGCTCGG + Exonic
1174591215 20:51646620-51646642 GAGGCAGCAGCTGCCCAGCTTGG + Intronic
1175180765 20:57145503-57145525 GAGGAATCAGGGGCCCTGCTGGG + Intergenic
1175321904 20:58094239-58094261 GTGGCAGCAGCGGCCCCACCTGG - Intergenic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1176023727 20:62975373-62975395 GTGGCAGAAGGGGCCCGGCAGGG + Intergenic
1176030530 20:63009144-63009166 GCCGCAGCAGGGGCCTCACCCGG - Intergenic
1176120772 20:63453590-63453612 GAGGCAGGAGGGGCGCCGCGGGG + Intronic
1176123745 20:63465924-63465946 ACGGCAGCAGAGGACCCGCCGGG - Intronic
1176140796 20:63544201-63544223 GAGGCAGGAGGGGCCGCCCCAGG + Intronic
1176190268 20:63805576-63805598 GAGGCAGGAAGGACCCTGCCTGG + Intronic
1176512912 21:7762141-7762163 GAGGCAGCAGGAGCCCAACCTGG + Intronic
1178647025 21:34392665-34392687 GAGGCAGCAGGAGCCCAACCTGG + Intronic
1179616436 21:42586503-42586525 GCCACAGCAGGGGCCCCGGCAGG + Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1179903471 21:44406934-44406956 GAAGTAGAAGGGGCCCCACCAGG + Intronic
1179966239 21:44807777-44807799 GAGGCAGAGGGAGCCCTGCCTGG - Intronic
1180003060 21:45003829-45003851 GAGGCAACCGAGGCCCAGCCAGG - Intergenic
1180167762 21:46038846-46038868 GAGGCAGCCGGGTGCCCACCTGG - Intergenic
1180971093 22:19816100-19816122 GAGGCAGCCGGGGCCCCGCGAGG - Intronic
1181140003 22:20797396-20797418 GAGGCAGCTGGGGACACTCCTGG + Intronic
1182578736 22:31291226-31291248 GAGGCAGCGGAGGCCCGGCGCGG + Exonic
1183232204 22:36590078-36590100 GATGCAGCTGGGGCCCTGCTGGG - Intronic
1183315829 22:37136375-37136397 GAGTCAGCAGGGGGGCCTCCTGG + Exonic
1183525964 22:38322864-38322886 CAGGCAGCAGAGGCCCGGCCCGG - Intronic
1183539088 22:38419304-38419326 GAGGCAGGAGGGGCTCAGACAGG + Intergenic
1184391149 22:44204419-44204441 GAGGCACCTGAGGCCCAGCCAGG + Intronic
1184561269 22:45264248-45264270 GAGGCAGCAGGTGCCTAGCCAGG + Intergenic
1184645494 22:45892591-45892613 GAGGCAGGAGGGGACCTGCCAGG - Intergenic
1184648581 22:45909202-45909224 GAAGCTGCAGGGGCGCAGCCAGG - Intergenic
1184769608 22:46589571-46589593 GGGGCAGCATGGGCCCTTCCAGG - Intronic
1185068603 22:48644293-48644315 GGGGCAGCAGGGGCCTCCCCTGG - Intronic
1185155207 22:49189470-49189492 CAGGCATCAGAGGCCCCACCTGG - Intergenic
1185177051 22:49333880-49333902 TGGGCAGGAGGGACCCCGCCTGG + Intergenic
1185301110 22:50081668-50081690 GAGGCAGAAGAAGCCCCGTCGGG + Intronic
1185318650 22:50190216-50190238 GAGGCTGCAGGGGCCAGGGCTGG + Intronic
1185335738 22:50270205-50270227 GCGGCTGCAGGGGCTGCGCCCGG - Exonic
1185372068 22:50465557-50465579 GAGGCGGCAGGGGCCCAGCAAGG - Intronic
949938586 3:9136330-9136352 GAGGCAGCAGATGCCGGGCCGGG + Intronic
949982197 3:9508838-9508860 GAGGCAGGAGCGCACCCGCCTGG - Intronic
950421026 3:12899583-12899605 AAGGCAGCGGGGGCTCCGCCGGG + Intronic
950435379 3:12976258-12976280 GGGGCAGCAGTGGCCGCCCCAGG + Intronic
950500863 3:13362749-13362771 CAGGAAACAGGGGCCACGCCTGG - Intronic
952873219 3:37920541-37920563 GAGGCTGCAGAGGCCCTGCCAGG + Intronic
953447374 3:42979617-42979639 GAGCCGGCCGGGGCACCGCCGGG + Exonic
954339272 3:49940119-49940141 GTGGTAGCAGTGGCCCCGCGCGG + Exonic
954363074 3:50132720-50132742 CAGGGAGAAGGGGCCCAGCCTGG + Intergenic
954437281 3:50502996-50503018 GGGGAAGCAGGGGCACCGCGGGG + Intronic
955327587 3:58021161-58021183 GTGGGAGCAGGGGCCCGGCCTGG + Intronic
955860576 3:63325579-63325601 AGGCCAGCAGGGGCCCTGCCAGG - Intronic
959884131 3:111479179-111479201 GAGGCAGCCGGGGACCTGGCGGG - Intronic
960987312 3:123289526-123289548 AAGGCAGCAGAGGCATCGCCAGG + Intronic
961529870 3:127533883-127533905 GAGGAAGCTGGGGTCCAGCCAGG - Intergenic
961539068 3:127588300-127588322 GCAGCAGCAGGGGCACCACCTGG - Intronic
961558798 3:127714744-127714766 GAGGCAGGAGGGGACCCGGGTGG + Intronic
961735921 3:129002093-129002115 GGGGCAGCCGGGGCCCCGCACGG - Exonic
961750318 3:129090571-129090593 CAGGAAGCAGGTTCCCCGCCTGG + Exonic
961807732 3:129501322-129501344 CAGGTAGCAGTGGCCCAGCCAGG + Intronic
962134751 3:132722183-132722205 GCGGCAGCAGGGGCCGGGCCCGG - Exonic
963068018 3:141279248-141279270 GAGGCAGCAGGGGCCACCGTGGG - Intronic
964751666 3:160059351-160059373 GAGGCATGAGGGGCCAGGCCAGG + Intergenic
966711881 3:182980332-182980354 CAGGCAGGAGAGCCCCCGCCTGG + Intronic
966907742 3:184539956-184539978 GTGGCCGCAGGGGAACCGCCTGG + Intronic
966929369 3:184665792-184665814 GGGAAAGCAGAGGCCCCGCCGGG - Intronic
968048122 3:195635373-195635395 GAGGCCGCTGGGGACCCGGCAGG - Intergenic
968099280 3:195954247-195954269 GAGGCCGCTGGGGACCCGGCAGG + Intergenic
968306489 3:197654548-197654570 GAGGCCGCTGGGGACCCGGCAGG + Intergenic
968509712 4:990206-990228 GCGGCACCAGGGGCCCGGCATGG - Exonic
968641213 4:1716107-1716129 AAGGCAGCAGGGGCCATGGCCGG - Exonic
968786114 4:2623463-2623485 AAGACAGCAGGGGACCGGCCAGG - Intronic
969388351 4:6871999-6872021 GAGGCAGGAGGGTCGCCGCCAGG + Intronic
969398303 4:6937593-6937615 GGGGCAGCAAGGGCCCTGCCAGG + Intronic
970381754 4:15515289-15515311 AAGGCAGCAGGGGCCTGGCCTGG + Intronic
970733716 4:19140672-19140694 GGGGAAGCAGGCACCCCGCCTGG + Intergenic
971260794 4:25054843-25054865 AAGGCAGCAGGGGCCTCACAGGG + Intergenic
972890487 4:43551424-43551446 GAGGCAGCTGAGGCCCAGCGTGG - Intergenic
976223967 4:82780811-82780833 GAGGCCCCAGGGGGCCAGCCTGG + Intronic
982198527 4:152937766-152937788 GACGCAGCTGGGGCTCCGCGCGG + Intronic
983810090 4:172050811-172050833 GAGGGAGCAGGGACCCCTCTTGG - Intronic
984834948 4:184010819-184010841 GAAGCAGCGGGGCCCCCACCCGG - Exonic
985440480 4:189980090-189980112 GAGGCAGCAGGGGCTCGGACTGG - Intergenic
985452626 4:190069714-190069736 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985453613 4:190073011-190073033 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985454603 4:190076304-190076326 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985455591 4:190079597-190079619 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985456575 4:190082891-190082913 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985457563 4:190086191-190086213 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985458550 4:190089484-190089506 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985459539 4:190092784-190092806 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985463790 4:190175553-190175575 GAGGCTGCAGGGGCCCGGGCGGG - Intronic
985504687 5:272020-272042 GAGACCGCGGGGGACCCGCCAGG - Intronic
985578241 5:683602-683624 GAGCCAGCATGGCCCCTGCCAGG - Intronic
985593168 5:775742-775764 GAGCCAGCATGGCCCCTGCCAGG - Intergenic
985696510 5:1344065-1344087 GAAGGAGCAGGGGCCACGCTTGG - Intronic
985743426 5:1633575-1633597 GAGACCGCGGGGGACCCGCCAGG + Intergenic
985759213 5:1736349-1736371 GAGTCAGCATGGGCACCACCAGG - Intergenic
985933951 5:3080262-3080284 CAGGCAGCAGGGGCGCTGCATGG + Intergenic
986616336 5:9621197-9621219 GTGGCAGCAGCGGCCTGGCCTGG + Intergenic
993901136 5:93584897-93584919 GAGGGGGCGGGGGGCCCGCCGGG - Exonic
994497808 5:100535633-100535655 CAGGCAGCCGAGGCCGCGCCAGG + Exonic
995846052 5:116494819-116494841 GAAGGAGCAGGGACCTCGCCAGG - Intronic
996403474 5:123086625-123086647 GTGGAGGCAGGGGCCCCGCTCGG + Intergenic
997120051 5:131164765-131164787 GAGGCAGCCGGGGAACCGGCGGG + Intronic
997480035 5:134177830-134177852 CAGGCAGCCAGGGCCCGGCCTGG + Intronic
997698236 5:135878264-135878286 GAGGCAGCCAGGGCCCAGCTTGG - Intronic
998128641 5:139640121-139640143 GAGGCAGCAGAGACACTGCCAGG - Intergenic
999382040 5:151128112-151128134 GAGCCAGGAGAGTCCCCGCCTGG + Intronic
1001528842 5:172448176-172448198 GCAGCAGCATGGGCCCAGCCTGG + Intronic
1001764454 5:174234489-174234511 GAGGCAGCTGGGGCCCTGTGGGG - Intronic
1002055830 5:176597475-176597497 GAGGCCGCAGCGCCCCCGCCGGG - Exonic
1002277459 5:178113429-178113451 GAGCCAACCTGGGCCCCGCCCGG - Exonic
1002297129 5:178237978-178238000 GAGGATGGAGGGGCCCAGCCTGG - Exonic
1002419268 5:179137245-179137267 GTGGCAGCTGGGGACCCTCCTGG - Intronic
1002421986 5:179153684-179153706 GAGGCAGCTGAGGCCCCTGCTGG + Intronic
1002691920 5:181055858-181055880 TAGCCAGCAGGGGTCCTGCCTGG - Intronic
1006423506 6:33949852-33949874 GAGGCAGCACGGGAGCAGCCAGG + Intergenic
1006514150 6:34536725-34536747 GACACAGCAGGGGCCCAGCGAGG + Intergenic
1007077631 6:39078135-39078157 GAGGCAGCAGGAGCCCCATGCGG - Intronic
1007665542 6:43510827-43510849 GAGGCCCCAGGGGCCACGGCTGG + Intronic
1011090625 6:83594442-83594464 GATGCTGCAGGGGCCTCCCCAGG + Exonic
1012133014 6:95519790-95519812 AAGGCAGCAGGAGGCCGGCCTGG + Intergenic
1013180416 6:107712566-107712588 GAGGCAGCAGGGGCCTGGCTCGG + Intronic
1017437985 6:154435741-154435763 CTGGCAGCAGAGGCCCAGCCTGG + Intronic
1017812156 6:157991057-157991079 GAGGGAGCATGTGCCACGCCAGG + Intronic
1018254184 6:161902158-161902180 GAGGCAGCATAAGCCCAGCCAGG - Intronic
1018978195 6:168581761-168581783 GAGGCAGCGGGGTCCCAGGCAGG - Intronic
1019119996 6:169794665-169794687 GGGGGTGAAGGGGCCCCGCCTGG + Intergenic
1019492982 7:1323720-1323742 GGGGCGGCAGGGGCCCGGCGGGG + Intergenic
1019544446 7:1566774-1566796 GTGGCAGCCTGGGCCCCGCCTGG - Intergenic
1019743710 7:2688253-2688275 GAGCCGGCAGAGGCCGCGCCGGG - Intronic
1019812543 7:3175205-3175227 GAGGAGGCAGGGGCCCCGGGAGG - Intergenic
1020088475 7:5324166-5324188 GAGGCTCCAGCAGCCCCGCCCGG + Intronic
1022455706 7:30556577-30556599 GAGGCAGCAGAGGCCCGGCATGG + Intergenic
1022489392 7:30805142-30805164 CTGGCAGCAGGGCCCCTGCCGGG + Intronic
1023081879 7:36533966-36533988 GGGGCGGCAGGGCCCCAGCCAGG - Intronic
1023246646 7:38212048-38212070 GAGGAAGCAGGCGACCAGCCAGG - Intronic
1024996006 7:55273651-55273673 CAGTCAGCAGGGGAGCCGCCCGG + Intergenic
1025205834 7:56992948-56992970 GAGGCTCCAGCAGCCCCGCCCGG - Intergenic
1025666106 7:63583990-63584012 GAGGCTCCAGCAGCCCCGCCCGG + Intergenic
1026112635 7:67470385-67470407 GAGGCAGCGGGGGACTCGCCTGG + Intergenic
1026947581 7:74326321-74326343 GAGGCAGCAGGCGCTCAGTCTGG - Intronic
1027261220 7:76465898-76465920 GAGGCATAAGGGTCCCGGCCAGG + Intronic
1027312604 7:76964006-76964028 GAGGCATAAGGGTCCCGGCCAGG + Intergenic
1027978457 7:85186856-85186878 GCGGCCGCAGGGGCCAGGCCGGG + Intergenic
1028268706 7:88759794-88759816 TCGGCAGCAGGAGCCCCGCACGG + Exonic
1028621554 7:92833912-92833934 GAGGTTGCAGGGGCCCCTCGGGG + Exonic
1029530091 7:101119733-101119755 GAGGCTGCAGGGGCCTAGCCTGG + Intergenic
1031078749 7:117238632-117238654 GAGGCAGCAGGGGACACACATGG - Intergenic
1032021641 7:128409936-128409958 GAGGCTCCCGGGGCCCCGGCTGG + Exonic
1032074431 7:128829867-128829889 GAGGAAGCAGGGACCTTGCCCGG - Intergenic
1033246534 7:139721096-139721118 GGGGCAGCAGGGGCCACACCAGG - Intronic
1034222881 7:149459819-149459841 GACGCAGCGCGGGCCCCGCAGGG + Intronic
1034416073 7:150964875-150964897 GATGCAGCAGGAGCCGCTCCTGG + Intronic
1035049167 7:155988558-155988580 GAGGCAGCTGGGGCCGTGCTGGG + Intergenic
1035748438 8:1978438-1978460 GGCGCAGCAGGGGCCCCTCGGGG + Intronic
1036627450 8:10483534-10483556 TAGGAAGCAGGGGCCCTGCTGGG + Intergenic
1037803589 8:22048060-22048082 GCGGCAGGGGCGGCCCCGCCAGG + Exonic
1038446556 8:27608613-27608635 GTGGCGGCAGGGGCCCAGACAGG - Intronic
1040072719 8:43201418-43201440 GAGGCAGGAGAAGCCCCGCTGGG - Exonic
1040386423 8:46917827-46917849 GGGCCAGCAGGGGGCGCGCCAGG + Intergenic
1040848358 8:51870866-51870888 GAAGCAGCAGGGGGCGGGCCGGG + Intronic
1042732731 8:71955067-71955089 GAGGCAACAGGTGCCCCTCAGGG + Intronic
1042865935 8:73356763-73356785 GAGGAGGCCGGGGCTCCGCCTGG - Intergenic
1045063746 8:98427874-98427896 TAGGGAGAGGGGGCCCCGCCAGG + Intronic
1045359112 8:101415445-101415467 AAAGCAGCGGGGGCCCTGCCTGG - Intergenic
1048554017 8:135457735-135457757 GCGGCAGCAGCGGCCAAGCCGGG - Exonic
1049259079 8:141629259-141629281 GAGGGAGCTGGGGCCCGGCATGG + Intergenic
1049582016 8:143417075-143417097 GAGGCCGCAAGGGCCCAGGCGGG + Intergenic
1049709673 8:144057876-144057898 GAGTCAGCAGGAGCCCACCCAGG - Exonic
1050009723 9:1173126-1173148 GGGGCAGCAGGGGCCCAGCCCGG - Intergenic
1050024500 9:1319980-1320002 GAGGCACCAGGGCCCCCTCTGGG - Intergenic
1050498398 9:6268212-6268234 GTGGCAGGAGGGGCCCGGCCAGG + Intergenic
1050564690 9:6869756-6869778 AAGGCAGCAAGGGCCTTGCCAGG + Intronic
1051513858 9:17907464-17907486 GAGGCACCAGGGAGCCCACCTGG - Intergenic
1052987764 9:34500762-34500784 GCGGCAGCAGGGTACCCACCTGG - Exonic
1053114761 9:35490634-35490656 GAGGGAGCAGAGGACCCGGCCGG - Intronic
1053270517 9:36746334-36746356 GGTGCAGCAGGGGCCCCTCGGGG - Intergenic
1055030637 9:71768963-71768985 GAGGAGGCGGTGGCCCCGCCCGG + Intronic
1056662057 9:88551045-88551067 GATGCAGCAGGGACCCCTCTTGG - Intronic
1057182131 9:93035902-93035924 GAGGCAGCATGGGCACTGCCAGG + Exonic
1057550687 9:96049372-96049394 GAGCCAGCCGGAGCCCAGCCAGG + Intergenic
1057600140 9:96450488-96450510 GCGGCGGCAGGAGCCCAGCCGGG + Exonic
1058746032 9:107991612-107991634 GAGCCAGCAGGGACCTCACCAGG - Intergenic
1059422144 9:114198867-114198889 GAGGCAGCTGAGGCCCAGCAAGG - Intronic
1060197727 9:121634299-121634321 GAGGAGGCAGAGGCCCCGGCCGG + Intronic
1060527058 9:124326643-124326665 CAGGGGGCAGGGGCCCCGCTTGG + Intronic
1060527833 9:124330528-124330550 GAGGCAGCACGGGCCCTGCATGG - Intronic
1061204088 9:129153052-129153074 AAGGAAGCTGGTGCCCCGCCTGG + Intergenic
1061463332 9:130757933-130757955 GAGGAAGCAATGGCCCCTCCAGG + Intronic
1061489336 9:130936563-130936585 GAGGAAGGCGGGGCCCGGCCTGG + Intronic
1061541027 9:131277855-131277877 GAGGCAGCGCGGGGCGCGCCAGG - Intergenic
1061609872 9:131739525-131739547 CGGGTTGCAGGGGCCCCGCCCGG + Intronic
1061943267 9:133894242-133894264 GGGGGAGCCGGGGCCCGGCCTGG + Intronic
1061955869 9:133961040-133961062 GAGGGAGCAGGGGCCTCCACTGG + Intronic
1061973196 9:134055649-134055671 GAGGCAGCAGCAGCACAGCCTGG - Intronic
1062016605 9:134294287-134294309 CAGGCAGCTCGGGCCTCGCCTGG + Intergenic
1062167237 9:135113933-135113955 GAGGCAGGAGGGTCCTCCCCTGG - Intronic
1062238300 9:135523066-135523088 CAGGCACCAGCGGCCCCTCCGGG - Intronic
1062287817 9:135780915-135780937 GAGGCCGGAGGAGCCGCGCCAGG - Intronic
1062321684 9:135993321-135993343 GCGGCAGCAGGCTCCCCTCCCGG + Intergenic
1062583047 9:137236755-137236777 GTGGGAGCTGGGGCCCCTCCTGG + Intergenic
1062624286 9:137435913-137435935 GAGCCAGCCTGGGCCCCTCCTGG + Intronic
1062625047 9:137438767-137438789 GGGGCAGCAGAGGCCTCGTCTGG + Intronic
1062687196 9:137819828-137819850 GAGAGAGCAGGGGCCACTCCGGG + Intronic
1203769173 EBV:40340-40362 GAGCCACCAGGGGCCCGGCGGGG + Intergenic
1185610738 X:1392521-1392543 GAGGCCGCGGCGACCCCGCCGGG + Exonic
1189364954 X:40381081-40381103 GAGGCTGCGGGGGCCCCAGCTGG - Intergenic
1190332300 X:49243297-49243319 GAAGCAGCAGGGGACTCGCCTGG - Exonic
1190738032 X:53268560-53268582 GAGGAAGCAGGGGCCTCGCCTGG - Intronic
1192175925 X:68885400-68885422 GAGTCAGCAGGTTCCCAGCCTGG + Intergenic
1192184988 X:68940716-68940738 AAGTCAGCATGGGCCCTGCCTGG + Intergenic
1192947975 X:75986235-75986257 AAGGCAGCAGGGGCCTTGACTGG - Intergenic
1195065398 X:101234529-101234551 GAGGCAGGAGGGGCTGAGCCAGG - Intronic
1196755824 X:119156279-119156301 AAGGGAGCAAGGGCCCAGCCAGG + Intergenic
1196793246 X:119482808-119482830 GAGGCGGCCGGAGACCCGCCTGG - Intergenic
1197445927 X:126552408-126552430 TAGGCGGGTGGGGCCCCGCCAGG - Exonic
1198533307 X:137565691-137565713 GAGGCAGCGGGGGCCCAAGCAGG + Intergenic
1200210802 X:154345850-154345872 CTGGCAGGAGGTGCCCCGCCAGG - Intergenic
1200220050 X:154386242-154386264 CTGGCAGGAGGTGCCCCGCCAGG + Intergenic
1200234014 X:154459630-154459652 GAGGCAGCTGGGGCCCCTGCAGG + Intronic
1200292414 X:154886101-154886123 GCAGCAGCTGGTGCCCCGCCAGG + Intronic
1200339257 X:155381841-155381863 GCAGCAGCTGGTGCCCCGCCAGG + Intergenic
1200347213 X:155458852-155458874 GCAGCAGCTGGTGCCCCGCCAGG - Intergenic
1201180034 Y:11334096-11334118 GAGGCTGCAGGGGCACAGGCGGG - Intergenic
1202048625 Y:20758663-20758685 GAGGGAACAGGGGCCCAACCTGG - Intronic