ID: 1167745957

View in Genome Browser
Species Human (GRCh38)
Location 19:51352020-51352042
Sequence GGGTAGCTCATCTCATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745957_1167745968 11 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745968 19:51352054-51352076 TGGTGCCCGAGGGTCTCCTGGGG No data
1167745957_1167745964 0 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745964 19:51352043-51352065 CTGAGCAGAGGTGGTGCCCGAGG No data
1167745957_1167745960 -9 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745960 19:51352034-51352056 GAGCTACCCCTGAGCAGAGGTGG No data
1167745957_1167745965 1 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745965 19:51352044-51352066 TGAGCAGAGGTGGTGCCCGAGGG No data
1167745957_1167745969 12 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745957_1167745967 10 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745967 19:51352053-51352075 GTGGTGCCCGAGGGTCTCCTGGG No data
1167745957_1167745966 9 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745966 19:51352052-51352074 GGTGGTGCCCGAGGGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745957 Original CRISPR GGGTAGCTCATCTCATTTGA GGG (reversed) Intronic