ID: 1167745961

View in Genome Browser
Species Human (GRCh38)
Location 19:51352040-51352062
Sequence CGGGCACCACCTCTGCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745961_1167745976 28 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data
1167745961_1167745969 -8 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745961_1167745968 -9 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745968 19:51352054-51352076 TGGTGCCCGAGGGTCTCCTGGGG No data
1167745961_1167745967 -10 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745967 19:51352053-51352075 GTGGTGCCCGAGGGTCTCCTGGG No data
1167745961_1167745975 27 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745975 19:51352090-51352112 CCATGTACCCCTATCTCAGTGGG No data
1167745961_1167745973 26 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745973 19:51352089-51352111 TCCATGTACCCCTATCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745961 Original CRISPR CGGGCACCACCTCTGCTCAG GGG (reversed) Intronic