ID: 1167745962

View in Genome Browser
Species Human (GRCh38)
Location 19:51352041-51352063
Sequence TCGGGCACCACCTCTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745962_1167745976 27 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data
1167745962_1167745969 -9 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745962_1167745973 25 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA No data
Right 1167745973 19:51352089-51352111 TCCATGTACCCCTATCTCAGTGG No data
1167745962_1167745975 26 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA No data
Right 1167745975 19:51352090-51352112 CCATGTACCCCTATCTCAGTGGG No data
1167745962_1167745968 -10 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA No data
Right 1167745968 19:51352054-51352076 TGGTGCCCGAGGGTCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745962 Original CRISPR TCGGGCACCACCTCTGCTCA GGG (reversed) Intronic