ID: 1167745963

View in Genome Browser
Species Human (GRCh38)
Location 19:51352042-51352064
Sequence CTCGGGCACCACCTCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745963_1167745975 25 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG No data
Right 1167745975 19:51352090-51352112 CCATGTACCCCTATCTCAGTGGG No data
1167745963_1167745973 24 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG No data
Right 1167745973 19:51352089-51352111 TCCATGTACCCCTATCTCAGTGG No data
1167745963_1167745969 -10 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745963_1167745976 26 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745963 Original CRISPR CTCGGGCACCACCTCTGCTC AGG (reversed) Intronic