ID: 1167745963

View in Genome Browser
Species Human (GRCh38)
Location 19:51352042-51352064
Sequence CTCGGGCACCACCTCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 200}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745963_1167745969 -10 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 220
1167745963_1167745975 25 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1167745975 19:51352090-51352112 CCATGTACCCCTATCTCAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 87
1167745963_1167745976 26 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 107
1167745963_1167745973 24 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1167745973 19:51352089-51352111 TCCATGTACCCCTATCTCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745963 Original CRISPR CTCGGGCACCACCTCTGCTC AGG (reversed) Intronic
900291616 1:1926132-1926154 GGCGGGCATCACCTGTGCTCAGG - Intronic
900643124 1:3696761-3696783 CTTGAGCCCCACCGCTGCTCGGG - Intronic
901190777 1:7408563-7408585 CCTGGGCAGCACCTCTGCCCTGG + Intronic
902389138 1:16092619-16092641 CACTGGCACCACCGCTGTTCCGG + Intergenic
903996075 1:27306308-27306330 CCCCGGCACCCCCACTGCTCAGG - Exonic
904379865 1:30103394-30103416 CCCTGGCACCCCATCTGCTCAGG + Intergenic
904592625 1:31623525-31623547 CCCCGGCACCACCTCAGCACTGG + Exonic
905207541 1:36351447-36351469 CTCTGGCACACCCTCCGCTCTGG - Intronic
905924509 1:41740199-41740221 CCCGGCCACCACCAATGCTCTGG + Intronic
906858390 1:49332013-49332035 CTTGGGAACCACCTCTGCCCTGG - Intronic
907305217 1:53509423-53509445 CTCCTGCACCTCCTCTGCCCTGG - Intronic
907519122 1:55011839-55011861 CTGGGGCACCCCCTCTCCACTGG + Intergenic
909579937 1:77222433-77222455 CTCATGCACGACCTCTGCTAAGG - Intergenic
912712268 1:111958482-111958504 CCCTAGCAGCACCTCTGCTCTGG - Intronic
913957924 1:143320694-143320716 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
914052233 1:144146052-144146074 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
914126964 1:144820489-144820511 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
918109072 1:181440111-181440133 CTCAGGCAGCACCTGTGATCAGG + Intronic
920053201 1:203175618-203175640 CTTGGGCACCTGCTCTTCTCTGG + Exonic
920224695 1:204429987-204430009 CTCGGCCACCGCCTCTCCCCGGG + Exonic
920449747 1:206051022-206051044 CTCAGGCGCCAGCCCTGCTCAGG - Intronic
922795051 1:228335683-228335705 CTCGGGCACAGCCCCTGCTCAGG + Intronic
1063074559 10:2701775-2701797 CTGGGGCTCATCCTCTGCTCCGG - Intergenic
1063459126 10:6204164-6204186 CTCGAGCTCCACCTCAGCTGCGG + Intronic
1063976754 10:11423641-11423663 CTCCGGCACCATCTTTCCTCTGG - Intergenic
1067208794 10:44241821-44241843 CTAGGGTACCAGCTCTGCTTAGG - Intergenic
1068461678 10:57337193-57337215 CTGGGCCTCCACCTCTGCTCTGG - Intergenic
1071671623 10:87614341-87614363 ATGGTACACCACCTCTGCTCTGG + Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1073578084 10:104641581-104641603 CTGGGGCAGCAGCTCTGGTCCGG - Exonic
1074787486 10:116853802-116853824 CTGGGGCCCCACCTCTGAACTGG + Intronic
1075446339 10:122516070-122516092 CTGTGGCAGCACCTCAGCTCCGG - Intergenic
1076347622 10:129790700-129790722 GTTGGGCACCACCACTGCCCTGG - Intergenic
1077079950 11:720825-720847 CTCGTGCACCAGCTCTGCCTGGG - Exonic
1078509589 11:11975605-11975627 CCAGAGGACCACCTCTGCTCAGG - Intronic
1081099326 11:38982626-38982648 GTGGGGCATCACCTCAGCTCAGG - Intergenic
1081152317 11:39647854-39647876 CTAGGGTACCACTTCAGCTCAGG - Intergenic
1087329017 11:96755911-96755933 CTGGGGAATCACCTCTGCCCTGG + Intergenic
1089310575 11:117555747-117555769 CTCAGCCACCACCTATGCACAGG - Intronic
1090506500 11:127320792-127320814 CTCATGCACAACCTCTGCTAGGG - Intergenic
1102333909 12:112060573-112060595 CATGGATACCACCTCTGCTCTGG - Intronic
1107997476 13:45874948-45874970 CTAAGGCACCAGCTCTGTTCTGG - Intergenic
1108530578 13:51323825-51323847 CTCGGACACCATGTCTGATCTGG - Intergenic
1115309744 14:31967206-31967228 CTCCTGGACCACCTCTGCCCTGG + Intergenic
1115773586 14:36691039-36691061 CTCAGGTACCTCGTCTGCTCTGG - Intronic
1117252408 14:53950680-53950702 CCCAGGCACCACTTCTGCTGGGG + Exonic
1118611882 14:67547669-67547691 CTGGGGGACCATCTCTGCTTAGG + Intronic
1118900342 14:69980820-69980842 CTCTGGCCCCACCTCTTTTCTGG - Intronic
1119494854 14:75069719-75069741 CTCGGGCACCGCTCCTGCTCAGG - Exonic
1120873150 14:89355950-89355972 AGCAGGCACCACCTCTGCCCAGG + Intronic
1121719065 14:96096680-96096702 CACTGGCACCACCTCTCCCCTGG - Intergenic
1122697352 14:103562546-103562568 GTGGGGCACCACCTCCGCGCGGG - Intronic
1122760296 14:104019958-104019980 CTACTGCACCACCTCTGCACTGG - Intronic
1202930458 14_KI270725v1_random:29380-29402 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1123421892 15:20142030-20142052 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1123443190 15:20304605-20304627 CTCGGGCCCTACCTCTGCCCTGG + Intergenic
1123531120 15:21148570-21148592 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1124635116 15:31360310-31360332 CTGGGGGGCCACCTCTTCTCAGG - Intronic
1125605012 15:40935217-40935239 CTCTGGCCCCCCATCTGCTCTGG + Intronic
1126379480 15:48031284-48031306 CATGGACACCTCCTCTGCTCTGG + Intergenic
1126705508 15:51401775-51401797 CTCAGGCAGCACCTGTGCTGTGG + Intronic
1129220243 15:74128252-74128274 CTCGGGCTCCAGCCCTGCCCGGG + Exonic
1132508626 16:325312-325334 CTCCGGCGCCCCCTCCGCTCTGG + Intronic
1132803941 16:1767093-1767115 GCCAGGCCCCACCTCTGCTCAGG - Intronic
1133102611 16:3488343-3488365 CTCGGGCTCCACCCCTGAGCAGG - Intergenic
1134640271 16:15824506-15824528 CTGGCGCATCACCTCAGCTCAGG - Intronic
1136718068 16:32301077-32301099 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1136836444 16:33507347-33507369 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1138475918 16:57270556-57270578 CTCGGTCCCCACCCCCGCTCTGG + Intronic
1139188234 16:64832663-64832685 CTCGTGGAGCACCTCTGCTAGGG + Intergenic
1203008360 16_KI270728v1_random:216688-216710 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1203146627 16_KI270728v1_random:1807648-1807670 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1143502576 17:7347796-7347818 CTGGGCCAGCACCTCTGCACGGG + Intronic
1144758798 17:17695389-17695411 CTCGGGCACCCCGCCTGCCCTGG + Intronic
1145771981 17:27499825-27499847 CTCGTACACCCCCTCTGCTTTGG - Intronic
1146486185 17:33244786-33244808 CTCGTTCAGCATCTCTGCTCAGG + Intronic
1147957221 17:44142639-44142661 GTTAGGCACCACCTCTGATCTGG + Intronic
1152471971 17:80494551-80494573 CTTGGGCACCAGCTCTGAGCAGG + Intergenic
1153816987 18:8799158-8799180 CTGGGGCACTCCCTCTGCACTGG + Intronic
1154415037 18:14171879-14171901 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1154415695 18:14174203-14174225 CCCTGGCCCCACCTCTGCCCTGG - Intergenic
1155647219 18:28093936-28093958 TTTGAGGACCACCTCTGCTCAGG - Intronic
1156036560 18:32771912-32771934 CTCGGGCACCCCCACTTCCCCGG + Intronic
1156398998 18:36724142-36724164 CTCGGGCATCTCCTCTGCATGGG + Intronic
1160248916 18:77184275-77184297 CTCAGGCACCAGCACTGCTCCGG - Intergenic
1160965216 19:1744460-1744482 GTCGGGGGCCAGCTCTGCTCTGG - Intergenic
1163666811 19:18607215-18607237 CTCGGCCCCCACCCCAGCTCTGG + Intronic
1163774144 19:19208199-19208221 CTCCCTCCCCACCTCTGCTCTGG + Intergenic
1163861379 19:19744692-19744714 CTCGGGAGCCACCTGGGCTCCGG - Intergenic
1165318893 19:35074141-35074163 CCCTGGCCCCACCTCTGCCCTGG + Intergenic
1166002542 19:39886301-39886323 GTCGGGCACCACCTCCTCCCAGG + Exonic
1167637947 19:50666401-50666423 CACCGCCACCACCTCTGCCCGGG - Exonic
1167745963 19:51352042-51352064 CTCGGGCACCACCTCTGCTCAGG - Intronic
1168031936 19:53687022-53687044 TTTGGGCATCACCTCTGCACAGG + Intergenic
1202691630 1_KI270712v1_random:98476-98498 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
925396396 2:3536550-3536572 CACAGGCCCCACCCCTGCTCCGG + Intronic
926159862 2:10479978-10480000 CTGGGGCCCCATCTCAGCTCTGG - Intergenic
927159814 2:20246501-20246523 CTCTGGCACCACCTCAGCGGAGG - Intergenic
927461022 2:23298274-23298296 CACTGCCACCACCGCTGCTCTGG - Intergenic
928090908 2:28374596-28374618 CCCGGGCAACCCCTTTGCTCCGG - Intergenic
929078107 2:38095246-38095268 CTCAGGCACTACCTCGTCTCCGG - Intronic
932780678 2:74556622-74556644 CTTGGACAGCACGTCTGCTCAGG + Exonic
933954758 2:87355474-87355496 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
934238954 2:90251700-90251722 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
934274240 2:91565010-91565032 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
934461385 2:94215036-94215058 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
934673999 2:96236636-96236658 CTCAGGAAGCACCTCTGCTAAGG + Intergenic
947497563 2:230649284-230649306 CTCAGTCACCACCTGGGCTCTGG + Intergenic
948454922 2:238100503-238100525 CCCGGGCATCACCGATGCTCTGG + Exonic
948692548 2:239715756-239715778 CTCGGGGACCTGCTCTGCTGTGG - Intergenic
1169818223 20:9680759-9680781 CTTTGGCAGCACCCCTGCTCCGG - Intronic
1173583997 20:44167986-44168008 CTGGGGCATCACCTCTCATCTGG - Intronic
1173830225 20:46079064-46079086 CTGGGGCACTCCTTCTGCTCTGG + Intronic
1176262244 20:64188001-64188023 CTGAGGCCCCACATCTGCTCAGG - Intronic
1176866167 21:14056277-14056299 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1176866964 21:14059126-14059148 CCCTGGCTCCACCTCTGCCCTGG - Intergenic
1179486864 21:41716073-41716095 CCAGGGCCCCACCTCTGCCCTGG - Intergenic
1179783914 21:43719215-43719237 CTCGGGCTCCGGCTCGGCTCGGG - Exonic
1180549832 22:16530151-16530173 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1180835677 22:18928409-18928431 CTCAGCCTCCACCTCAGCTCTGG + Intronic
1181354856 22:22291714-22291736 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1184250859 22:43259479-43259501 CTCTGGTACCAGCTGTGCTCAGG - Intronic
1184765244 22:46568949-46568971 CTCAAGGACCACCTTTGCTCTGG - Intergenic
1185118333 22:48950649-48950671 CACGGGCATCACCCCTGCTCTGG - Intergenic
1185288625 22:50013315-50013337 CTGGGGCCCAGCCTCTGCTCAGG + Intergenic
1203285766 22_KI270734v1_random:153708-153730 CTCAGCCTCCACCTCAGCTCTGG + Intergenic
950006195 3:9692582-9692604 CTCGGCCTCGGCCTCTGCTCTGG + Intronic
950053643 3:10009632-10009654 CACGGGCCCCGCCTCTTCTCTGG - Intronic
950305285 3:11911920-11911942 CACGGGCCCCGCCTCTTCTCTGG - Intergenic
950415503 3:12866955-12866977 CACGGGCCCTACCTCTTCTCTGG - Intronic
950417075 3:12874930-12874952 CACAGGCCCCACCTCTTCTCTGG - Intergenic
951739640 3:25906230-25906252 CTCTAGCCCCATCTCTGCTCTGG - Intergenic
954542131 3:51400581-51400603 CTTGGGCACCAACTCCCCTCTGG + Intronic
961961071 3:130855706-130855728 CTCAGGCATCACCTATTCTCTGG - Intronic
965077923 3:164002833-164002855 CTCAGGCACCTCCTCTGCCTGGG + Intergenic
965531394 3:169773598-169773620 CTGGGCCACAACCTCTGCTGTGG + Intronic
967574744 3:191076930-191076952 CTGGGGAATCACCTCTGCTCTGG - Intergenic
968892851 4:3380496-3380518 CTCGTGCAGAACCTCTGCTAGGG - Intronic
969405469 4:6988499-6988521 CACGGCCACCACATCTGCACAGG - Intronic
969511624 4:7621100-7621122 CTCAGGCACCTCCCCTGCTGGGG + Intronic
971170460 4:24228059-24228081 CTCGGGCACCAGCTACTCTCAGG + Intergenic
978640527 4:110866099-110866121 ATTGGGCACCTCCTCTGTTCTGG - Intergenic
979513439 4:121580173-121580195 CTCGGGCTAGACCTATGCTCTGG + Intergenic
983534728 4:168845120-168845142 CTCCCTCACCTCCTCTGCTCCGG - Intronic
983789677 4:171781016-171781038 CAATGGCACCACCTCGGCTCAGG - Intergenic
984095409 4:175427798-175427820 CTCGGCCTCCGCGTCTGCTCTGG + Intergenic
985681487 5:1258103-1258125 CCCGGCCAGCACCTGTGCTCTGG - Intronic
985839451 5:2295243-2295265 CACTGGCACCACCTCTGATGTGG - Intergenic
986208714 5:5649890-5649912 GTCAGGCACCAGCTCTGCTGTGG + Intergenic
987050730 5:14144670-14144692 CGCGGCCACCCCCTCTGCGCCGG - Intronic
989043006 5:37248941-37248963 CTCGGGCCACACCTCGGCACCGG - Intronic
989398509 5:40984069-40984091 CTCAGGCACCTTCTCTGCCCAGG - Intergenic
989682940 5:44050911-44050933 CTTGGGTACCACCTTTGCTAAGG - Intergenic
990740669 5:58909257-58909279 CACTGTCCCCACCTCTGCTCTGG - Intergenic
992068269 5:73126861-73126883 CTCTGGCAGCACCACTGCTGGGG - Intronic
994637667 5:102363312-102363334 CTCGGGGAGAACCTCTGCTAGGG - Intergenic
996901888 5:128552037-128552059 CTCGGATACCACTTCTGCTCAGG - Intronic
997629220 5:135354080-135354102 CTTGAGCACCAGCTCTGCTAGGG - Intronic
998193221 5:140043822-140043844 CTCAGCTACCACCTCTGCTTGGG - Intergenic
999106407 5:149075062-149075084 GTAGGGCACCACATCTGCTCAGG - Intergenic
1001100573 5:168810614-168810636 CTTGGTCACCACTTCGGCTCTGG + Intronic
1001201638 5:169723043-169723065 CCCGGGCACCACAGCTGCTCTGG - Intronic
1001641239 5:173245698-173245720 CGCGCGCACCAAATCTGCTCTGG + Intergenic
1006694513 6:35920406-35920428 CTCCGGCACCTTCTCTGCTCTGG - Intronic
1007250649 6:40492693-40492715 CAGGGGCACCTCCTCTGCTGGGG + Intronic
1011137793 6:84118289-84118311 CTGGGAAACCACCTCTGCCCTGG + Intergenic
1017408654 6:154146812-154146834 CTCTGGCCCCAACTCTTCTCTGG - Intronic
1018101554 6:160445349-160445371 CCCTGGCACCACCTCTCTTCAGG - Intronic
1018346212 6:162901634-162901656 CTGTGGCACCGCCTTTGCTCAGG + Intronic
1018838332 6:167501517-167501539 CTTGGGCACCACCAGTGCTTAGG + Intergenic
1019312864 7:371210-371232 CTTGGGCACCTACTCTGCGCTGG - Intergenic
1019606158 7:1911243-1911265 CCCTGGCACCACCTCTGCTCGGG + Intronic
1022466208 7:30654735-30654757 TTCTGTCACCACCTCTGCTCTGG + Intronic
1023981687 7:45074143-45074165 CTCTGGCTTCACCTCTGCACAGG - Intronic
1025078801 7:55964837-55964859 CTCCGGCCCCACCCCAGCTCCGG - Intronic
1028985832 7:97007349-97007371 CTCCGGCACCGCCTCCGCTGCGG + Intronic
1029655678 7:101922831-101922853 CAGGGGCAGCACCTCTGCACTGG + Intronic
1038180710 8:25224805-25224827 CATTGGCCCCACCTCTGCTCTGG + Intronic
1039891620 8:41689633-41689655 CCCAGTCACCACCTCTGCTGGGG - Intronic
1040055825 8:43056313-43056335 CTCCGCCACCACCTCAGCTGCGG + Exonic
1040691228 8:49941072-49941094 GTGGGGCACCCCCTCTTCTCAGG + Intronic
1044728081 8:95209035-95209057 CTCAGGAAGCACCTGTGCTCCGG + Intergenic
1045019200 8:98026968-98026990 CTCAGCCATCACCTCTGCTGGGG - Intronic
1049329633 8:142043313-142043335 CTCGGGCACCTGCCTTGCTCTGG - Intergenic
1049409042 8:142464293-142464315 CCCGGGCCCCGCGTCTGCTCCGG - Exonic
1049544960 8:143226240-143226262 CTCCAGCCCCACCTCTGCCCTGG + Intergenic
1049621649 8:143600932-143600954 CTCGGGCAGCATCTCTGCAAAGG - Exonic
1050205849 9:3195435-3195457 CTGGGGTACCACCTATGCTGGGG + Intergenic
1050205863 9:3195486-3195508 CTGGGGTACCACCTATGCTGGGG + Intergenic
1050898207 9:10910824-10910846 CTCGGCCTCGGCCTCTGCTCTGG + Intergenic
1052767002 9:32651200-32651222 CTCTGCCACCACCTCTGCAGTGG + Intergenic
1053381227 9:37650973-37650995 CTCGGGAAGCAGCGCTGCTCGGG - Intronic
1053691861 9:40590674-40590696 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1054272942 9:63046817-63046839 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1054303118 9:63391640-63391662 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1054401897 9:64718150-64718172 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1054435503 9:65202465-65202487 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1054494890 9:65819222-65819244 CTCTGGCCCTACCTCTGCCCTGG - Intergenic
1055301499 9:74887549-74887571 CTCTGACACCACCTCCGCTATGG + Intronic
1057285326 9:93749008-93749030 CTCAGGCAGAACCTCTGCTAGGG - Intergenic
1057577439 9:96254739-96254761 CTGGGGCACCAGCTCTCCTGGGG - Intronic
1061458008 9:130713079-130713101 CTCCGGCTCCAGCGCTGCTCAGG - Intergenic
1062236208 9:135509091-135509113 TTTGGGCACCACCTCTGACCAGG + Intergenic
1062491061 9:136805140-136805162 CTCCGGGTCCACCTCTGCTCTGG + Intronic
1203435286 Un_GL000195v1:131668-131690 CTCAGGAACCTCCTGTGCTCTGG + Intergenic
1203622524 Un_KI270749v1:136809-136831 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1203664814 Un_KI270754v1:15089-15111 CTCGGGCCTCACCTCTCCACGGG - Intergenic
1186639587 X:11441196-11441218 CTTGGGAAGCACCCCTGCTCTGG - Intronic
1190254456 X:48752184-48752206 CCTGGTTACCACCTCTGCTCTGG + Intergenic
1194953464 X:100153372-100153394 CTAGGGAACCACCTCTTCCCTGG + Intergenic
1197441304 X:126494478-126494500 CTCAGGCAGAACCTCTGCTAGGG + Intergenic
1198515857 X:137405970-137405992 CTGGGGCGCCACCGCGGCTCTGG + Intergenic
1199443754 X:147897460-147897482 CTCGGCCTCCGCGTCTGCTCTGG - Intergenic
1199964757 X:152810680-152810702 CTCTGCCAGCACCTCTGCCCTGG - Intergenic
1201190501 Y:11439240-11439262 CTCTGGCCCTACCTCTGCCCTGG + Intergenic
1202583096 Y:26402641-26402663 CTCTGGCCCTACCTCTGCCCTGG - Intergenic