ID: 1167745966 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:51352052-51352074 |
Sequence | GGTGGTGCCCGAGGGTCTCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1167745958_1167745966 | 8 | Left | 1167745958 | 19:51352021-51352043 | CCTCAAATGAGATGAGCTACCCC | No data | ||
Right | 1167745966 | 19:51352052-51352074 | GGTGGTGCCCGAGGGTCTCCTGG | No data | ||||
1167745957_1167745966 | 9 | Left | 1167745957 | 19:51352020-51352042 | CCCTCAAATGAGATGAGCTACCC | No data | ||
Right | 1167745966 | 19:51352052-51352074 | GGTGGTGCCCGAGGGTCTCCTGG | No data | ||||
1167745956_1167745966 | 21 | Left | 1167745956 | 19:51352008-51352030 | CCATGAGGTTTGCCCTCAAATGA | No data | ||
Right | 1167745966 | 19:51352052-51352074 | GGTGGTGCCCGAGGGTCTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1167745966 | Original CRISPR | GGTGGTGCCCGAGGGTCTCC TGG | Intronic | ||