ID: 1167745969

View in Genome Browser
Species Human (GRCh38)
Location 19:51352055-51352077
Sequence GGTGCCCGAGGGTCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 220}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745958_1167745969 11 Left 1167745958 19:51352021-51352043 CCTCAAATGAGATGAGCTACCCC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 220
1167745956_1167745969 24 Left 1167745956 19:51352008-51352030 CCATGAGGTTTGCCCTCAAATGA 0: 1
1: 0
2: 1
3: 11
4: 152
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 220
1167745961_1167745969 -8 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG 0: 1
1: 0
2: 1
3: 12
4: 128
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 220
1167745963_1167745969 -10 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG 0: 1
1: 0
2: 1
3: 14
4: 200
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 220
1167745957_1167745969 12 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC 0: 1
1: 0
2: 1
3: 10
4: 90
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 220
1167745962_1167745969 -9 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG 0: 1
1: 0
2: 0
3: 27
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745969 Original CRISPR GGTGCCCGAGGGTCTCCTGG GGG Intronic
900177207 1:1296189-1296211 GGTGCGTGTGGGGCTCCTGGAGG - Exonic
900227336 1:1539510-1539532 GGTGGGCGGGGGTCTCCTGGGGG - Intronic
900374144 1:2345645-2345667 TGTGTCCCAGGGTCTCCTCGAGG + Intronic
900396646 1:2455776-2455798 AGGGCCCGAGGGGCTCCCGGTGG - Intronic
900441466 1:2657660-2657682 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900441708 1:2658905-2658927 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900441938 1:2660068-2660090 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900442601 1:2663521-2663543 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900442831 1:2664684-2664706 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900443494 1:2668137-2668159 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900443724 1:2669300-2669322 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900444252 1:2672070-2672092 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900444495 1:2673315-2673337 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900444726 1:2674478-2674500 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900445157 1:2676726-2676748 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900445866 1:2680460-2680482 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900446105 1:2681704-2681726 GCTGCCGGATGCTCTCCTGGGGG - Intronic
900447561 1:2688973-2688995 GGTGTCCGATGCTCACCTGGGGG - Intronic
900448696 1:2694670-2694692 GGTGTCCAATGGTCACCTGGCGG - Intronic
900449474 1:2698527-2698549 GCTGCCCGATGCTCACCTGGGGG - Intronic
900450413 1:2746753-2746775 GGTGTCCGATGCTCACCTGGGGG - Intronic
900452943 1:2759478-2759500 GCTGCCCGATGCTCACCTGGGGG - Intronic
901744567 1:11363862-11363884 ATTGGCCGAGGGTCTCTTGGGGG + Intergenic
901790342 1:11650544-11650566 GGTGCCCGAGGGCGGCGTGGAGG - Exonic
902538167 1:17133632-17133654 GGGGCCCCGGGGTCTCCTGTGGG + Intergenic
902676122 1:18009577-18009599 GGTGCCAGGGGGACTCCTGCAGG - Intergenic
903446425 1:23425043-23425065 GGCGCCCGAGGGTGTCCCAGGGG + Intergenic
910673943 1:89799022-89799044 GGTTCCAGAAGGTCTCCTGCAGG - Intronic
912548133 1:110465861-110465883 GGGGCCCCAGTGTCCCCTGGAGG + Intergenic
913536673 1:119779551-119779573 GGCCCCCGAAGGCCTCCTGGGGG - Intergenic
920226913 1:204445966-204445988 GGAGCCCCAGGGCATCCTGGTGG + Exonic
1063543865 10:6961406-6961428 GGTCCCAGAGGGCCTCTTGGAGG + Intergenic
1064302229 10:14132767-14132789 GCTGCCAGAGGGCCTGCTGGTGG + Intronic
1067043284 10:42969952-42969974 GGAGGCCCAGGGTCTCCTGAGGG + Intergenic
1069908713 10:71747163-71747185 TGAGCCCCAGGGTCTCTTGGAGG - Intronic
1070853201 10:79584310-79584332 GGAGCCCCTGGGTTTCCTGGGGG + Intergenic
1070879225 10:79843908-79843930 GCTGCCCGAGGGTCTCCCTCGGG - Intronic
1071632331 10:87227998-87228020 GCTGCCCGAGGGTCTCCCTCGGG - Intronic
1071645784 10:87360216-87360238 GCTGCCCGAGGGTCTCCCTCGGG - Intronic
1072253783 10:93601403-93601425 TGTGCCCGAGGCTGTCCTGGAGG - Exonic
1073353185 10:102834176-102834198 GCTGCCAGAGTCTCTCCTGGAGG + Intronic
1074778209 10:116781742-116781764 AGTGCCTGAGGGTCTGCTGTGGG + Intergenic
1076725948 10:132413380-132413402 GGTGCCCGCGGGCGTCCCGGTGG + Intronic
1076879117 10:133231250-133231272 GGTGCCCCAGGGTCTGCAGCAGG - Exonic
1077212019 11:1375479-1375501 GGTGCCCCAGGGTGAGCTGGGGG + Intergenic
1077340822 11:2025632-2025654 GGTGCCCGAGGCTCTTCTAGGGG - Intergenic
1077491303 11:2862244-2862266 GGTCCCAGGGGCTCTCCTGGAGG + Intergenic
1078152762 11:8773301-8773323 GGTGCCAGAGTGGCTCATGGTGG - Intronic
1079082041 11:17420476-17420498 AGTGCCCCTGGGTTTCCTGGAGG - Intronic
1080923109 11:36728665-36728687 GGAGCCCATCGGTCTCCTGGGGG + Intergenic
1083681094 11:64352219-64352241 GCTGCCCGCGGGTCTCCTCCTGG - Exonic
1083883058 11:65557931-65557953 GGGCCCCGAGGGGCTGCTGGCGG - Exonic
1084066075 11:66705133-66705155 GGTGGCCGAGGGTCACCCTGGGG - Exonic
1084174820 11:67417677-67417699 GGTGCCCAAGGGCTCCCTGGAGG + Exonic
1085396755 11:76210356-76210378 GGTGCCCAAGGGGGTCGTGGCGG + Intronic
1202823807 11_KI270721v1_random:80821-80843 GGTGCCCGAGGCTCTTCTAGGGG - Intergenic
1092247608 12:6872394-6872416 GGTGCCAGAGAGACTGCTGGTGG - Exonic
1092317931 12:7439697-7439719 GGAGCCCGAGACTCACCTGGAGG - Intronic
1101789620 12:107914862-107914884 GGTGATGGAGAGTCTCCTGGAGG + Intergenic
1102305841 12:111804010-111804032 GGGGCTTGAGGGTCTGCTGGTGG + Intronic
1102381197 12:112468253-112468275 TGTGCCCTAGGGACTGCTGGTGG + Intronic
1102937659 12:116911199-116911221 GCTGGCCCAGCGTCTCCTGGAGG + Exonic
1103931812 12:124454552-124454574 GGTCCCCGGGGGCCTCCTGGGGG - Intronic
1105354089 13:19642171-19642193 GGAGCCCGAGATTCACCTGGAGG + Exonic
1105701718 13:22939677-22939699 GGTGCCCCAGGGTCCCTTGGGGG - Intergenic
1105854334 13:24361466-24361488 GGTGCCCCAGGGTCCCTTGGGGG - Intergenic
1107872931 13:44763776-44763798 TGTGCCCTGAGGTCTCCTGGTGG + Intergenic
1108903938 13:55447293-55447315 GGTCCCAGTGGGTCTCCTAGAGG + Intergenic
1112353181 13:98653686-98653708 TGTGCACGAGAGTCACCTGGAGG - Intergenic
1113949567 13:114064494-114064516 GCTGTCCGTGGGTCTCATGGTGG + Intronic
1114269599 14:21092636-21092658 GGCTCCCGAGCGTCCCCTGGCGG - Exonic
1114452604 14:22836972-22836994 CGAGCCCGGGGGTCTCCTAGGGG + Intronic
1119743092 14:77026909-77026931 GCTCCCCCAGGGGCTCCTGGGGG - Exonic
1119968583 14:78944226-78944248 GGTGCCTGTGGTTCTACTGGTGG - Intronic
1121008000 14:90502459-90502481 GGTTCCCGAGGTGCTCTTGGGGG - Intergenic
1122843108 14:104476305-104476327 GGTGTCCCAGGGTCCCTTGGGGG - Intronic
1123218148 14:106831405-106831427 GGTGGCTGAGCCTCTCCTGGTGG + Intergenic
1124888716 15:33711585-33711607 GATGACCTAGGGTATCCTGGTGG - Intronic
1130891927 15:88140796-88140818 GGTGGTCCAGGGTGTCCTGGGGG - Intronic
1131153704 15:90062335-90062357 GGGGACCGAGGGCATCCTGGTGG + Intronic
1131155999 15:90075976-90075998 AGTGCCTCAGAGTCTCCTGGAGG + Intronic
1131268575 15:90933073-90933095 CAGGCCCTAGGGTCTCCTGGAGG - Intronic
1131340580 15:91596998-91597020 GGTTACAGAGGGTTTCCTGGAGG + Intergenic
1131799265 15:96052989-96053011 GGTCCCCGAGGCTCTCGTGCTGG + Intergenic
1132092045 15:98954913-98954935 GGTGAGGGAGGGTCTCCTGGTGG + Intronic
1132149657 15:99450643-99450665 GGTGCCTCAGGGTCCCCTGGAGG + Intergenic
1132553799 16:564160-564182 AGTCCCAGAGGGGCTCCTGGGGG - Exonic
1132606784 16:796978-797000 AGGGCTCGAGGGTCTGCTGGGGG + Exonic
1132959221 16:2612858-2612880 GGTGCCTGCGGGTGCCCTGGAGG - Intergenic
1132972281 16:2694833-2694855 GGTGCCTGCGGGTGCCCTGGAGG - Intronic
1133346107 16:5071702-5071724 TGGCCCCGAGGGGCTCCTGGGGG + Intronic
1133350503 16:5097842-5097864 GGGGCCCGGGGGTCCCCCGGGGG + Intergenic
1134229870 16:12420450-12420472 GAAGCCCGTGGGTCTGCTGGAGG + Intronic
1135864706 16:26090626-26090648 GGGCCCCGAGGGTCTCCAAGGGG - Intronic
1136568369 16:31082964-31082986 GGTGCCACTGGGGCTCCTGGGGG - Exonic
1137290872 16:47051155-47051177 GGTGCCAGATGGGCTACTGGGGG - Intergenic
1138651278 16:58463115-58463137 GGAGCCCGAGGGTGTCCTTGAGG - Intronic
1139692681 16:68651096-68651118 GGTGCCCGAGGGAGCCCTGTTGG + Intronic
1141081460 16:81056770-81056792 GGTCCTCTAGGGTCTCATGGTGG - Intronic
1142265479 16:89062341-89062363 GGAGCTGCAGGGTCTCCTGGTGG + Intergenic
1142708376 17:1710218-1710240 GGCGCCCACGGGGCTCCTGGTGG - Exonic
1142765988 17:2064660-2064682 TGTGCCCCAGGGACCCCTGGGGG + Intronic
1143408772 17:6696194-6696216 GCTGCTCCAGGGTCACCTGGGGG + Intronic
1143762464 17:9115375-9115397 TGTTCCCCAGGGTCTCCCGGGGG + Intronic
1144184988 17:12788883-12788905 GATGCCCCTTGGTCTCCTGGTGG + Intergenic
1144554258 17:16267879-16267901 GGTGTCCCAGGCTCTCCTGGTGG + Intronic
1144627523 17:16851978-16852000 GGTGTTGGAGGGTCTCCTGGAGG - Intergenic
1144816700 17:18039922-18039944 GGGGCCCGAGGGCCTCCTCGCGG + Intronic
1144878916 17:18420741-18420763 GATGTTGGAGGGTCTCCTGGAGG + Intergenic
1145094227 17:20010045-20010067 GGTGCCCGTGGGTTTCCCGGTGG + Intronic
1145153319 17:20523653-20523675 GATGTTGGAGGGTCTCCTGGAGG - Intergenic
1145227348 17:21141196-21141218 GGTGACCGGTGGCCTCCTGGGGG - Intronic
1145910734 17:28540628-28540650 TTTGACAGAGGGTCTCCTGGAGG - Intronic
1146185191 17:30720064-30720086 GATGCCTGAGGGCTTCCTGGAGG + Intergenic
1147581657 17:41630672-41630694 GGTGTTGGAGGGTCTCCTGGAGG - Intergenic
1148534646 17:48429634-48429656 GGTCCCCGAGGCTCTCCAGGGGG - Intronic
1150097581 17:62391225-62391247 GATCCACGAGGATCTCCTGGAGG + Intronic
1152111845 17:78360954-78360976 GGCGCCCTGGGGTCTCCTAGGGG + Intergenic
1152312374 17:79559017-79559039 GGGCTCCCAGGGTCTCCTGGTGG - Intergenic
1156667071 18:39421477-39421499 AATGCCTGAGGCTCTCCTGGAGG + Intergenic
1160490659 18:79334733-79334755 GGCGCCGGTGGGTCTCCTGGGGG - Intronic
1160683339 19:422539-422561 GGTGCACGAGGGACTCCCCGGGG - Intronic
1161108619 19:2456415-2456437 GGGTCTCGAGGGTCTCCAGGGGG - Intronic
1161323799 19:3653340-3653362 CATGCCCGAGGGGCTCCTGCTGG - Exonic
1161352894 19:3803668-3803690 GCTCCCCGAGGGCTTCCTGGAGG - Intergenic
1161820682 19:6529137-6529159 GGGTCCCGAGGGGCTCCTGCCGG + Intergenic
1161908766 19:7177075-7177097 GGTTCCCAAAGGACTCCTGGGGG - Intronic
1162262421 19:9543735-9543757 GGAGCCGGAGGGTGTCCTGTTGG - Intergenic
1162334670 19:10053009-10053031 GGTGCCTGGGGATCTCCCGGAGG + Intergenic
1163159508 19:15456496-15456518 GCTCACCCAGGGTCTCCTGGAGG + Exonic
1163338014 19:16686327-16686349 GGAGCCAGCGGGTCTGCTGGAGG - Exonic
1163528342 19:17834956-17834978 GGCCCCCGAGTGTCTCCGGGAGG - Exonic
1163606970 19:18280969-18280991 CGTGCCCGAGGGCCCCCCGGCGG + Exonic
1164081001 19:21861298-21861320 GGAGCAGGAGGGTCTCCTGTTGG - Intergenic
1164989580 19:32674684-32674706 GGAGGCCTAGGGTCTGCTGGAGG - Intronic
1167446216 19:49539112-49539134 GGTCCTCCAGGGTTTCCTGGAGG - Exonic
1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG + Intronic
926154758 2:10447843-10447865 GGGGCCGCAGGGTCTCCGGGTGG + Intronic
926752613 2:16210208-16210230 CGTGCCCCAGCTTCTCCTGGGGG - Intergenic
929536445 2:42787207-42787229 GGTGCCTGAGTGTCCCCTGAGGG - Intronic
937152148 2:119693237-119693259 GGCACCCCAGGGTCTCCAGGGGG - Intergenic
945235075 2:207625636-207625658 GGTGCCCTGGGCTCTCCTAGCGG + Intronic
947151304 2:227118676-227118698 GGTGACCCAGGGTTTCCAGGAGG - Exonic
947792166 2:232874741-232874763 GGTGCCCTAGGGTCGCCGGCTGG + Intronic
948515390 2:238500181-238500203 TGTGCCCCAGGGGCTGCTGGAGG - Intergenic
948523747 2:238558097-238558119 GGTCCCCGAGGGCCTACTGATGG + Intergenic
948567305 2:238895377-238895399 GGTGCTGGAGGGCCTTCTGGGGG - Intronic
948786735 2:240356580-240356602 GGTCCCCGAGTTTCTCCAGGAGG - Intergenic
948912410 2:241011139-241011161 GGTTCTCCTGGGTCTCCTGGGGG + Intronic
948983691 2:241507940-241507962 GGGGCTCCAGAGTCTCCTGGGGG - Intronic
1169202071 20:3716234-3716256 TGTGCCCGAGTGAATCCTGGGGG + Intergenic
1171444699 20:25195460-25195482 GTTCCCCGAGCGTCTCATGGCGG - Intergenic
1172529133 20:35618286-35618308 TGTGCTTGAGGGTCTCTTGGGGG + Intronic
1173654409 20:44689919-44689941 TGTTCCCTAGGGCCTCCTGGAGG + Intergenic
1174266846 20:49338135-49338157 GGTGACGGAAGGTCTCATGGGGG + Intergenic
1175461116 20:59152659-59152681 GGTGCCCGAGGCTTCCCTGAGGG + Intergenic
1175677798 20:60961757-60961779 GGTGCCCCAAGGTCACCTGGAGG - Intergenic
1175931714 20:62496651-62496673 GGTCTGCGAGGGTCTCCAGGAGG + Intergenic
1175962943 20:62646228-62646250 GGTGCACAGGGCTCTCCTGGAGG + Intronic
1177806480 21:25879861-25879883 GGTGTCCGAAAGTCTCCAGGTGG - Intergenic
1179092429 21:38279158-38279180 AGTGCCTGAGGGTCTACGGGAGG + Intronic
1181758817 22:25043651-25043673 GGTGGCCCAAGGTGTCCTGGAGG + Intronic
1182125015 22:27810011-27810033 GGTGTCTGAGGGTTCCCTGGGGG - Intergenic
1184062328 22:42091008-42091030 GCGGCCCGAGCGTCCCCTGGCGG - Intergenic
1184691875 22:46121102-46121124 GGGTCCCCAGGGTCCCCTGGGGG - Intergenic
1184758844 22:46533564-46533586 GGTTCCTGAGGCTCTCCAGGAGG + Intronic
1184859615 22:47165714-47165736 AATGCCCGAGGGCCTCCTGCTGG + Intronic
1184981631 22:48099776-48099798 GAAGCCCGAGGGGCTCCCGGGGG + Intergenic
1185179452 22:49350646-49350668 GGTGCCGCAGGGTGCCCTGGAGG - Intergenic
1185271042 22:49929443-49929465 GGTGCTCGAGGGGCGCCTGCGGG + Intergenic
1185334789 22:50266661-50266683 TGTGACTGTGGGTCTCCTGGAGG - Intronic
952751941 3:36831743-36831765 GGTTCCCGAGAGGCTCCTGAAGG - Exonic
954109767 3:48427547-48427569 GGTGCCCCAGAGGCTCTTGGGGG - Intronic
954654978 3:52188874-52188896 GCTGCCCAAGGGGCTACTGGTGG - Intergenic
958932792 3:100225454-100225476 GGTGCCCGAGCGGCTGCTGGGGG + Intergenic
961414980 3:126750570-126750592 GGTGCTAGAGGGTCTGCTAGGGG + Intronic
961734361 3:128992133-128992155 GGAACCTGAGGTTCTCCTGGAGG - Intronic
961772577 3:129260818-129260840 GGGGGCCGTGGGTGTCCTGGGGG - Intronic
962248874 3:133822499-133822521 GGTGCCTGACAGTCTACTGGGGG + Intronic
964356231 3:155854241-155854263 GCTGCCCGGGGGTCTCCTTCAGG - Exonic
965559055 3:170044614-170044636 GGTTCCCCAGGGTGTCCTGCAGG + Intronic
966928863 3:184662903-184662925 GGGGCCCGACGGTGTGCTGGGGG + Intronic
967200039 3:187064876-187064898 GGTGCCAGATGTTCTCCTTGTGG - Intronic
968046965 3:195630003-195630025 TCTGCCCAAGGGTCTCTTGGGGG - Intergenic
968307688 3:197660041-197660063 TCTGCCCAAGGGTCTCTTGGGGG + Intergenic
968569363 4:1331407-1331429 GCTGCCCCGGGCTCTCCTGGTGG + Intronic
968881416 4:3302201-3302223 GGCGCACGGGGGTATCCTGGAGG + Intronic
968897626 4:3413981-3414003 CGTGTCCCAGGGTCTCCTGTGGG + Intronic
968962687 4:3753352-3753374 GGTGCAGGAGGGCTTCCTGGAGG + Intergenic
969249493 4:5957566-5957588 GGGGCCACAGGGTCTCCAGGGGG + Exonic
969602636 4:8185967-8185989 GGTGCCACAGGGTCCCCTTGGGG + Intronic
972280872 4:37601135-37601157 GGGGCCTGAGGTTCTCCTGATGG - Intronic
976229542 4:82827382-82827404 GGTGCCCCAGGGGCTCCTATTGG - Exonic
981952145 4:150422702-150422724 GGTTCCAGAGGCTCACCTGGTGG - Intronic
984183637 4:176515394-176515416 GATGCCCCAGGGTTTCCTTGAGG - Intergenic
986010900 5:3714271-3714293 GGAGACAGAGGGTCTCCTGGAGG + Intergenic
986299431 5:6466416-6466438 GTGGCCCGTGGGCCTCCTGGGGG + Intronic
990954425 5:61329450-61329472 GGTGGCCGTGGGCATCCTGGTGG + Intergenic
991720774 5:69492933-69492955 GGAGCCCGAGGGTCCCCGTGGGG + Intronic
991899099 5:71439267-71439289 GGTGGACGAGTGTCTACTGGAGG - Intergenic
992174848 5:74139807-74139829 GGTGCCCCATGGTGTCTTGGGGG - Intergenic
993898899 5:93571188-93571210 AGTGCCCGAGGCTTTCCTGAAGG - Intergenic
995891834 5:116962370-116962392 GTTGTCCCAGGGTATCCTGGGGG - Intergenic
997128635 5:131254197-131254219 TGTGCCCCAGGGCCTGCTGGGGG - Intronic
997235699 5:132270931-132270953 GGTGCCTGAGGGCCGCCTGCTGG - Exonic
997512878 5:134465535-134465557 GGGGCCAGTGGGTCTCCTGGTGG - Intergenic
997740140 5:136245990-136246012 GATGCCAGATAGTCTCCTGGAGG - Intronic
999176937 5:149638461-149638483 GGGGCCCAAGAGTCTGCTGGAGG + Intergenic
1001381940 5:171311172-171311194 TGTGCCAGAGGGTCTCCAGGAGG - Intronic
1001652648 5:173327048-173327070 GGTGGGCGAGGGTCTCGGGGTGG + Intronic
1002915719 6:1526289-1526311 GCTGCCGGAGGGTAACCTGGAGG - Intergenic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006394659 6:33779328-33779350 GCTGCCCGAGGGGCTTCTGCTGG + Intronic
1007133541 6:39499261-39499283 GGTGCAAGAGGGCTTCCTGGAGG + Intronic
1007653191 6:43435810-43435832 GGTGATCAATGGTCTCCTGGAGG + Exonic
1017537410 6:155363349-155363371 GGAGCCCGTGGAGCTCCTGGGGG - Intergenic
1019429230 7:991041-991063 GGGGCCCGAGGGTCCCCTGCAGG - Intergenic
1019517938 7:1447858-1447880 GGTGCCCGGGGGGGACCTGGGGG + Intronic
1019698197 7:2459718-2459740 GGTACCTGGGGGTCTTCTGGAGG - Intergenic
1024961382 7:54980688-54980710 GGCGCCCGAGGGCGTCCTGGGGG - Intergenic
1026129278 7:67606810-67606832 GGTGTCAGGGGGTCTTCTGGGGG + Intergenic
1032847019 7:135759687-135759709 GGTGCCTTAGGGTCTGGTGGAGG + Intergenic
1034971836 7:155424112-155424134 GATGAACGAGGGTGTCCTGGAGG - Intergenic
1035072838 7:156157546-156157568 GATGCCACAGGGTGTCCTGGGGG + Intergenic
1035326806 7:158070916-158070938 GGTGCTGGAGGTGCTCCTGGTGG + Intronic
1036789316 8:11707906-11707928 TGTGGCCGCGGGTGTCCTGGAGG + Exonic
1040464176 8:47679096-47679118 GGTGCCAGAGGGCACCCTGGTGG - Intronic
1048849914 8:138635011-138635033 GGTGGCCCAGGGTTCCCTGGGGG + Exonic
1049720972 8:144115387-144115409 GGTGCCCGAGGGTATCACGGAGG - Exonic
1049770191 8:144376448-144376470 GGTGGCCCGGGGTCTACTGGAGG + Intronic
1052347536 9:27425504-27425526 GCTGCCCCAGGCTCTGCTGGGGG - Intronic
1053007542 9:34614056-34614078 GGAGTCCAAGGCTCTCCTGGAGG - Exonic
1053052880 9:34976450-34976472 GGGCCCCGAGGGTGCCCTGGAGG + Intronic
1057146638 9:92763665-92763687 GCTGGTCGAGGGTCTCCAGGCGG - Intronic
1057183098 9:93040313-93040335 GGTTCCCCAGGGGCACCTGGTGG + Intergenic
1057707989 9:97411867-97411889 GGTGCGGGAGCGCCTCCTGGTGG - Intergenic
1061002429 9:127910043-127910065 GGAGCCCGACTGCCTCCTGGGGG + Exonic
1061169078 9:128941593-128941615 TGTGCCCGACAGTCCCCTGGAGG + Intronic
1061304428 9:129724265-129724287 GGTGCCCCAGGCTCTCCTGCTGG - Intergenic
1061618199 9:131793924-131793946 GGTGGCTGAGGGTCAGCTGGTGG + Intergenic
1061873116 9:133531165-133531187 AGAGCCCGAGGGGCTGCTGGGGG + Intergenic
1062181111 9:135191779-135191801 AGTGCCCGAGGGTGACCTGGGGG + Intergenic
1062512857 9:136917024-136917046 GGGGCCCGAGTGCCTGCTGGTGG - Intronic
1203792713 EBV:160230-160252 GGTGCCCGAGCCCCGCCTGGCGG + Intergenic
1190302700 X:49065686-49065708 GCTGGCAGAGGGTCTGCTGGTGG + Intronic
1195792439 X:108602984-108603006 GGTGTCCCAGGTGCTCCTGGAGG - Exonic
1198562047 X:137861029-137861051 AGTGCACCAGAGTCTCCTGGAGG + Intergenic
1200066697 X:153507395-153507417 TGGACCCGAGGGTCTCCAGGTGG + Intronic