ID: 1167745969

View in Genome Browser
Species Human (GRCh38)
Location 19:51352055-51352077
Sequence GGTGCCCGAGGGTCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745962_1167745969 -9 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745961_1167745969 -8 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745957_1167745969 12 Left 1167745957 19:51352020-51352042 CCCTCAAATGAGATGAGCTACCC No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745958_1167745969 11 Left 1167745958 19:51352021-51352043 CCTCAAATGAGATGAGCTACCCC No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745956_1167745969 24 Left 1167745956 19:51352008-51352030 CCATGAGGTTTGCCCTCAAATGA No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data
1167745963_1167745969 -10 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG No data
Right 1167745969 19:51352055-51352077 GGTGCCCGAGGGTCTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745969 Original CRISPR GGTGCCCGAGGGTCTCCTGG GGG Intronic