ID: 1167745976

View in Genome Browser
Species Human (GRCh38)
Location 19:51352091-51352113
Sequence CATGTACCCCTATCTCAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167745971_1167745976 8 Left 1167745971 19:51352060-51352082 CCGAGGGTCTCCTGGGGGAACAG No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data
1167745972_1167745976 -2 Left 1167745972 19:51352070-51352092 CCTGGGGGAACAGATGAGCTCCA No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data
1167745961_1167745976 28 Left 1167745961 19:51352040-51352062 CCCCTGAGCAGAGGTGGTGCCCG No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data
1167745970_1167745976 9 Left 1167745970 19:51352059-51352081 CCCGAGGGTCTCCTGGGGGAACA No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data
1167745962_1167745976 27 Left 1167745962 19:51352041-51352063 CCCTGAGCAGAGGTGGTGCCCGA No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data
1167745963_1167745976 26 Left 1167745963 19:51352042-51352064 CCTGAGCAGAGGTGGTGCCCGAG No data
Right 1167745976 19:51352091-51352113 CATGTACCCCTATCTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167745976 Original CRISPR CATGTACCCCTATCTCAGTG GGG Intronic