ID: 1167748294

View in Genome Browser
Species Human (GRCh38)
Location 19:51365684-51365706
Sequence GGAGCCAACCTGACTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167748294 Original CRISPR GGAGCCAACCTGACTGAGCT GGG (reversed) Intronic
900554734 1:3274629-3274651 GGAGCCGACGTGACAGAGCCTGG - Intronic
900789915 1:4673061-4673083 GCTGACAACCTGAATGAGCTTGG + Intronic
901853203 1:12029129-12029151 GCAGCCATCCTGAGTGAGCAGGG + Exonic
904233932 1:29101268-29101290 GGTACCTACCTGATTGAGCTAGG - Intronic
904255405 1:29251497-29251519 GGAGCCAGGCTGGCTGAGGTCGG + Intronic
905830890 1:41066384-41066406 GCAGCCTACCTGGCTGAGATTGG - Intronic
909271429 1:73627909-73627931 AGAGCCAGCATTACTGAGCTTGG + Intergenic
909879189 1:80851050-80851072 GGGGCTAACTTGTCTGAGCTAGG - Intergenic
912502329 1:110130525-110130547 GGAGCCAGGCTGGCCGAGCTGGG + Intergenic
918961929 1:191290430-191290452 GGCAGCAACCTGAATGAGCTTGG - Intergenic
920561118 1:206939192-206939214 GGAGTCATCCTGGCTCAGCTGGG + Exonic
924472363 1:244353766-244353788 GGAACCAACCTTCCTGAACTGGG + Intronic
1063268849 10:4484907-4484929 GGAGCCACCCTGACAGAGGAGGG - Intergenic
1066344048 10:34565019-34565041 AGAGCCAATCTGCCTGATCTTGG - Intronic
1067729381 10:48799050-48799072 GGAGCCAGACTGGCTGAGCATGG - Intronic
1069824429 10:71246411-71246433 GGAGCCCACCTGAGGGAGGTGGG + Intronic
1070643308 10:78184441-78184463 GATGCCCACCTGACTGAGCCAGG - Intergenic
1071155377 10:82682500-82682522 GGAGTCAACCTGATTTAGTTAGG + Intronic
1072411182 10:95203513-95203535 AGAGTCACCCTGAATGAGCTTGG + Intronic
1073208785 10:101782334-101782356 GAAGTCATCCAGACTGAGCTGGG + Exonic
1073374950 10:103025377-103025399 GGAGCCAACTTGGCTGGGCGTGG - Intronic
1073454228 10:103626938-103626960 TGGGCCAACCTTACTGAGATGGG + Intronic
1074698958 10:116076384-116076406 GGAGCCAAGCTGACAAAGATGGG + Intronic
1076067094 10:127457484-127457506 AGAGGCAACCTCACAGAGCTGGG + Intergenic
1076220155 10:128727402-128727424 GGACACATCCTGACTGACCTAGG + Intergenic
1077208984 11:1359604-1359626 GGAGCCGTCCTGACTGTCCTTGG + Intergenic
1078177404 11:8980394-8980416 TTAGCAAACCTCACTGAGCTTGG - Intergenic
1078815309 11:14815406-14815428 GAGGACAACCTGAATGAGCTTGG - Intronic
1079090071 11:17474726-17474748 TGTGCCAACCTCTCTGAGCTGGG - Intronic
1080344981 11:31314573-31314595 GGCACCAACCTGAATGAGCTTGG - Intronic
1081750717 11:45508976-45508998 GGAGGTAACCTGATTCAGCTTGG - Intergenic
1083707129 11:64524416-64524438 GGAGCCCAACTGAGTGAGGTGGG + Intergenic
1084001169 11:66296078-66296100 GAAGCCAACCTGGCTGGGCATGG - Exonic
1085312035 11:75522531-75522553 GGAACCAAGCTAGCTGAGCTAGG - Intronic
1087956157 11:104290105-104290127 GTGGACAACCTGAATGAGCTTGG - Intergenic
1088802243 11:113316813-113316835 AGATCCAACCTGCCTGAACTTGG - Intronic
1089005489 11:115087450-115087472 GGAGCCAAGCTGCCAGTGCTGGG + Intergenic
1089182379 11:116591962-116591984 GGAGACAACCACACTGAGATGGG - Intergenic
1091012860 11:132022144-132022166 GGAACCTCCATGACTGAGCTGGG + Intronic
1091439332 12:500502-500524 GGAGCCAGGATAACTGAGCTGGG + Intronic
1096333181 12:50732607-50732629 GGAGCCAGGCTGCCTGGGCTTGG + Intronic
1096480143 12:51934668-51934690 GGAGCCATCCAGAAGGAGCTGGG - Intergenic
1101243822 12:102865578-102865600 GGTGTCCACCTGACTGAGCTGGG + Intronic
1101680700 12:106961547-106961569 GGAGCCTACCTAGTTGAGCTGGG + Intronic
1102622096 12:114204240-114204262 AGGGCCAACCTGACTGGGATTGG - Intergenic
1104176845 12:126341337-126341359 GGATCCACCCTGCCTGAGGTGGG + Intergenic
1104849914 12:131867936-131867958 GGAGCTCACATGACTGAGCTTGG + Intergenic
1105433759 13:20360143-20360165 GGAGCCAATCAGACTGAGTTTGG + Intergenic
1108932260 13:55839918-55839940 GGAGCCCACCTACCTGAGCTGGG + Intergenic
1110614820 13:77529880-77529902 AGAGCCTAACTGACTGAGCAGGG + Intergenic
1119879543 14:78089646-78089668 GGAGACAAGCTGGCTGAGGTAGG - Intergenic
1120148922 14:81011084-81011106 GGAACTAACATGACTGAGTTGGG + Intronic
1121662971 14:95649693-95649715 TGAACCAACATGTCTGAGCTGGG + Intergenic
1122165443 14:99819814-99819836 GCAGCCAGCCTCACTGGGCTGGG + Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124579597 15:30941779-30941801 GGAGCCACCCAGGCTGATCTGGG + Exonic
1126113364 15:45187952-45187974 GGGGCCAGCCAGACTGAGCGAGG + Intronic
1129309720 15:74698057-74698079 GGAGAAAACCTAACTGATCTTGG - Intergenic
1130984457 15:88835887-88835909 TGAGTCAACCTGACTGGGCCGGG - Intronic
1131291439 15:91110486-91110508 GGAGCCACCCTCACTGGGCCTGG - Intronic
1132338284 15:101062754-101062776 GGCGCCACCCTGACATAGCTAGG - Intronic
1133311189 16:4847721-4847743 TGAGCTACCCTGACGGAGCTCGG + Intronic
1136989291 16:35142344-35142366 GGAGTCAAACGGACTGGGCTTGG + Intergenic
1138091274 16:54176620-54176642 GGGGCCGACCTGCCTGAGCGAGG + Intergenic
1138218250 16:55224641-55224663 GGAGCCAACATGAGGGATCTGGG - Intergenic
1138551090 16:57748889-57748911 GGATCCAAGCTGAGTGGGCTGGG + Intronic
1145838122 17:27970236-27970258 GGAGCCAACATGAAAGACCTTGG - Intergenic
1145882629 17:28363598-28363620 GGAGACAACCTGACAGATCTGGG - Exonic
1146593790 17:34152455-34152477 ACATCCAACCTGACTGAGATGGG - Intronic
1148434686 17:47674025-47674047 GAACCAAATCTGACTGAGCTAGG - Intronic
1149293391 17:55238546-55238568 GCAGCCAACGTGACGGGGCTGGG + Intergenic
1151549525 17:74814145-74814167 GGAGCCAAGCAGACTGAGAGTGG + Intronic
1156865481 18:41884694-41884716 GGAGAAAACCTGGTTGAGCTGGG + Intergenic
1156939281 18:42745248-42745270 GTATCCAACATGAGTGAGCTGGG - Intronic
1157736570 18:50054895-50054917 GGAGCCAGCCTGCCTGGGTTGGG - Intronic
1157808004 18:50672632-50672654 GGAAGCAACCCCACTGAGCTTGG + Intronic
1157988689 18:52469632-52469654 GGTGCCCACCTGACTTAGGTTGG + Intronic
1158956364 18:62543528-62543550 GAGGCCAGCCTGACTGAGCGTGG - Intronic
1160331794 18:77999966-77999988 TGAGCCAACCTCACTGCCCTGGG - Intergenic
1163598474 19:18233908-18233930 GGAGCCTACCTTCCTGGGCTTGG - Intronic
1164674410 19:30091985-30092007 GGAGCCGAAATGAGTGAGCTTGG - Intergenic
1165216423 19:34276977-34276999 GCAGCCAACCTGTCTAATCTAGG - Intronic
1165595545 19:37009203-37009225 GGAGCCAAAGGGACTGGGCTGGG + Intronic
1165601901 19:37060877-37060899 GGAACCAACGGGACTGGGCTGGG + Intronic
1166258742 19:41623677-41623699 GGAGCCTAACTGACTGAGGGGGG - Intronic
1166728252 19:45041966-45041988 AGAGGACACCTGACTGAGCTTGG - Intronic
1167463096 19:49636569-49636591 GGAGCCTCCCAGACTGAGATGGG + Intronic
1167476673 19:49705364-49705386 GGAGTCCGCCTGACTGAGCTGGG + Intronic
1167748294 19:51365684-51365706 GGAGCCAACCTGACTGAGCTGGG - Intronic
925442607 2:3901263-3901285 GGAGACAGCATGACAGAGCTCGG - Intergenic
925492241 2:4407621-4407643 GCTGACAACCTGAGTGAGCTTGG + Intergenic
927899705 2:26810606-26810628 TGAGCCAACCAGACAGAGCATGG + Intergenic
931399643 2:61919293-61919315 GGAGCCACCGTGCCTGGGCTCGG + Intronic
931965337 2:67527425-67527447 GGAGGAAACCTGACTGACTTTGG + Intergenic
935404844 2:102698242-102698264 AGAGCCATCCTGAATGTGCTTGG - Intronic
935884787 2:107604816-107604838 GGAGTCTGCCTGACTGAGTTGGG + Intergenic
936462552 2:112723606-112723628 GGTGCCTACCTGCCTGGGCTGGG + Intronic
936731269 2:115384223-115384245 TGAGCCAACCTGCCTGGACTGGG - Intronic
937916868 2:127103602-127103624 GGAGCCGGCCTGACGGAGCTGGG - Intronic
938699015 2:133859737-133859759 GGATCCAACCTGTCTTTGCTGGG + Intergenic
943026579 2:182636801-182636823 GCCAGCAACCTGACTGAGCTGGG - Intergenic
944904538 2:204249673-204249695 GGAAGTAACCTGACTGAGCTGGG - Intergenic
947927073 2:233931011-233931033 GGAACCCACCTGAGTGACCTTGG + Intronic
948567434 2:238895921-238895943 GGACCCAGGCTGACTGTGCTTGG - Intronic
1170940437 20:20844190-20844212 GCAGCCAGCGGGACTGAGCTGGG - Intergenic
1171532985 20:25864246-25864268 GGAACCAAGGTGACTGGGCTGGG - Intronic
1173500815 20:43551766-43551788 GGAACCTACCTGACCGAGATTGG + Intronic
1174779575 20:53376541-53376563 GGAGTTGACCTGACTCAGCTAGG + Intronic
1175405523 20:58723457-58723479 GGAGGCCACCTGCCTGGGCTTGG - Intergenic
1176588954 21:8621508-8621530 GGAACCAACTAGACTCAGCTGGG + Intergenic
1177766907 21:25469096-25469118 ACAGCCAACCTGAATGCGCTTGG - Intergenic
1178322068 21:31613333-31613355 GGAGAGAGCGTGACTGAGCTGGG - Intergenic
1179160037 21:38887562-38887584 GGATCCAACCCCACTGAGCATGG - Intergenic
1180271781 22:10598506-10598528 GGAACCAACTAGACTCAGCTGGG + Intergenic
1182035278 22:27193483-27193505 GCTGCAAACATGACTGAGCTGGG - Intergenic
1182105321 22:27685039-27685061 GGAGCCTCCCTGACTGAAGTGGG - Intergenic
1182776900 22:32837988-32838010 GGAGACATCCTGCCTGAGCTGGG - Intronic
1183707110 22:39480916-39480938 GAAGCCACCCTGACTCACCTGGG + Intronic
1183735445 22:39642407-39642429 GGAGCCCACCTGGCAGAGCTGGG - Intronic
949138364 3:600262-600284 GGAACCAACTAGACTCAGCTGGG - Intergenic
950090227 3:10289815-10289837 GGAGCCAGCCTGCTAGAGCTCGG + Exonic
950441293 3:13012228-13012250 GGAGCTGACCTGGCTGTGCTAGG - Intronic
951195089 3:19814715-19814737 GGAGCCAAGCTAACTCTGCTGGG + Intergenic
952184306 3:30952390-30952412 GGAGCTAACTGGGCTGAGCTGGG + Intergenic
955500131 3:59575120-59575142 GGGGCCACCCCCACTGAGCTGGG - Intergenic
964290278 3:155170793-155170815 GGAGCAAACCAGTCAGAGCTGGG - Intronic
973637664 4:52875125-52875147 GGGGCCAGCCTGTCTGCGCTGGG - Intronic
976850820 4:89542457-89542479 GGAGCCATAGAGACTGAGCTGGG - Intergenic
978549914 4:109914444-109914466 GGAGCCAAACTGCCAAAGCTAGG + Intronic
981749150 4:148076763-148076785 TGAGCCAGCCTGACTGAGGGTGG - Intergenic
982064127 4:151637572-151637594 GAAGGAAACCTAACTGAGCTGGG + Intronic
983323922 4:166228388-166228410 CGACCCAAGCTGGCTGAGCTTGG - Intergenic
984599224 4:181706928-181706950 GATGGCAACCTGGCTGAGCTAGG - Intergenic
985820628 5:2157650-2157672 GGTGTGAACCTGACTGGGCTAGG + Intergenic
986587875 5:9337313-9337335 GGAGTCAAACTGACTGGGTTTGG + Intronic
989953400 5:50328483-50328505 GGAACCAACCTAACTAAACTAGG + Intergenic
991457777 5:66822881-66822903 GGAGTCAACCTGACCAAGGTTGG + Intronic
997723182 5:136097340-136097362 GGAGCCAGGCTGACTGGTCTAGG + Intergenic
999450672 5:151675469-151675491 AGAGCCAATCTGGCTGAGCTTGG - Intronic
1001567075 5:172706785-172706807 GCAGCCAAGCTGACTGTGATAGG + Intergenic
1002023618 5:176382342-176382364 GCTGCCAACCTAGCTGAGCTTGG + Intronic
1002102278 5:176863496-176863518 GGGGCCAGCCAGACTCAGCTGGG + Intronic
1004550958 6:16646665-16646687 GGATTCCACCTGACAGAGCTGGG - Intronic
1005268328 6:24136855-24136877 AGTGTCAACCTGACTGACCTAGG + Intronic
1006595311 6:35188854-35188876 CTAGCCATCCTGTCTGAGCTTGG - Intergenic
1007293778 6:40805972-40805994 GGAGCCAGCATGTCAGAGCTGGG - Intergenic
1011884650 6:92078784-92078806 GCAGCCAGCCTCACTGAGCTGGG - Intergenic
1013310667 6:108890647-108890669 GAAGCCAAGCTGCCTGAGTTTGG - Intronic
1013903877 6:115190921-115190943 GCAAACAACCTGAATGAGCTTGG + Intergenic
1017623080 6:156318543-156318565 GGGGACATCCTGACTGGGCTGGG - Intergenic
1018410210 6:163537706-163537728 GGAAGTAACCTGACTGAACTTGG - Intronic
1019266673 7:121122-121144 GGAGGCAACCTGAATGCCCTCGG + Intergenic
1022701151 7:32761820-32761842 GGACCTCGCCTGACTGAGCTGGG - Intergenic
1023133189 7:37024187-37024209 GGAGCCAGTCTGTCTGAGTTTGG + Intronic
1030859598 7:114608323-114608345 GCAGACAACTTGAATGAGCTTGG - Intronic
1033075235 7:138243655-138243677 GCAGTCAAACTGACTGGGCTGGG - Intergenic
1033562118 7:142542161-142542183 GGTGCCAACCTGACCAGGCTAGG - Intergenic
1035590515 8:809640-809662 CGAGTCAACCTGACTGAAATTGG + Intergenic
1035605355 8:926727-926749 GGAGCTAAACTGAGTGAGCCAGG + Intergenic
1035966270 8:4195775-4195797 GCACACAACCTGAATGAGCTTGG + Intronic
1036771208 8:11579352-11579374 GCAGCCAATCTGGATGAGCTGGG + Intergenic
1037475622 8:19254061-19254083 GAAGGCCACGTGACTGAGCTTGG + Intergenic
1039304843 8:36250161-36250183 TGTGTCAACCTGACTGAGCCAGG - Intergenic
1040583177 8:48714107-48714129 ACAGCCAACCTGACTGACCTTGG - Intronic
1042018845 8:64347717-64347739 TTATCAAACCTGACTGAGCTGGG - Intergenic
1044315501 8:90745917-90745939 GAAGCCAACTTGACTGTGGTGGG + Intronic
1044920965 8:97169113-97169135 GGAGCCAGCTTGCCTGAGTTTGG + Intergenic
1046044705 8:108949825-108949847 GGAGGCAATCAGACTGACCTGGG - Intergenic
1046261478 8:111773887-111773909 AGAGCAAACCTGACTGGGCATGG - Intergenic
1048189448 8:132274835-132274857 GGAGCCAACCTTACAGAGTGTGG + Intronic
1051569747 9:18542338-18542360 AGAGCCAACATGACTGAGTCAGG - Intronic
1051789515 9:20784615-20784637 AGAGACAGCTTGACTGAGCTGGG + Intronic
1052415685 9:28173956-28173978 GGATATAACCTCACTGAGCTTGG - Intronic
1058866109 9:109163851-109163873 GGAGGGAACCTGACTGACCTTGG - Intronic
1203618962 Un_KI270749v1:100087-100109 GGAACCAACTAGACTCAGCTGGG + Intergenic
1186186016 X:7020449-7020471 GCAGCCAAACTGCCTGAGATGGG - Intergenic
1191588628 X:62856581-62856603 GAAGCCAACTTGATTGTGCTGGG - Intergenic
1201065311 Y:10090559-10090581 GGAGCAGACATGACTGAGCTGGG - Intergenic