ID: 1167748703

View in Genome Browser
Species Human (GRCh38)
Location 19:51367588-51367610
Sequence CAGCTAGCTCATCTTGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167748703_1167748712 1 Left 1167748703 19:51367588-51367610 CCAGCCGCAAGATGAGCTAGCTG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1167748712 19:51367612-51367634 GCCTGGTGGGGGCTGCACCCAGG 0: 1
1: 0
2: 1
3: 42
4: 450
1167748703_1167748711 -10 Left 1167748703 19:51367588-51367610 CCAGCCGCAAGATGAGCTAGCTG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1167748711 19:51367601-51367623 GAGCTAGCTGGGCCTGGTGGGGG 0: 1
1: 0
2: 42
3: 1603
4: 24466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167748703 Original CRISPR CAGCTAGCTCATCTTGCGGC TGG (reversed) Intronic
921947541 1:220896424-220896446 CAGCAAGCTCGGCTTGCTGCGGG - Intergenic
1065522287 10:26584547-26584569 GAGCTAGCCCCGCTTGCGGCTGG - Intergenic
1072754862 10:98012641-98012663 CAGCAAGCTCATTTGCCGGCAGG - Intronic
1077755223 11:5021611-5021633 CAGCTAGCTCTTCAGGTGGCAGG + Intergenic
1082087200 11:48059739-48059761 TAGCTACCTCATCAGGCGGCTGG - Intronic
1089675764 11:120088029-120088051 CAGGGAGCTCATCTGGCGGGAGG + Intergenic
1092366502 12:7881249-7881271 CAGCTCCCTCAGCTTGCGGGAGG + Intronic
1096072204 12:48781653-48781675 CATCTAGCTCATGTTGCTGTTGG - Intronic
1100441662 12:94622929-94622951 AAGCTAGCTCATGTTTCAGCTGG + Intronic
1104077662 12:125404707-125404729 CAGCTAGTCCTTCTTGCAGCTGG + Intronic
1104142890 12:126005410-126005432 CAGCTAGTTCATCTATGGGCTGG + Intergenic
1106384644 13:29272251-29272273 CAGTTAGCTAATCATGCAGCTGG + Intronic
1106770561 13:32957480-32957502 CAGGTGGCTCAGCTTGCAGCTGG + Intergenic
1109133579 13:58619545-58619567 CAGCCAGCTCATCTGGGGACAGG - Intergenic
1116096248 14:40373027-40373049 CAGCTTGCTCAGCCTGGGGCTGG + Intergenic
1124499257 15:30212318-30212340 AGGCTGGCTCATCTTGGGGCGGG - Intergenic
1124744322 15:32326352-32326374 AGGCTGGCTCATCTTGGGGCGGG + Intergenic
1144863905 17:18322898-18322920 TAGGAAGCTCATCTGGCGGCTGG - Exonic
1148848546 17:50542878-50542900 CAGGTATCTCACCTTGCAGCCGG + Exonic
1151176891 17:72296074-72296096 GTGCAAGCTCATCTTGCGGCAGG - Intergenic
1151866380 17:76806099-76806121 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1152231137 17:79114683-79114705 CAGCTAGCACATCCAGCGGCTGG + Intronic
1156865671 18:41886271-41886293 CAGCTGGCTCTTCTGGAGGCAGG - Intergenic
1165064527 19:33221283-33221305 CAGCTTGTTCATCTTGTTGCGGG + Intronic
1167748703 19:51367588-51367610 CAGCTAGCTCATCTTGCGGCTGG - Intronic
1168150642 19:54446107-54446129 CAGATTCCTCATCTTGCAGCTGG - Intergenic
926751291 2:16200607-16200629 CAGCTCACTCATCTTCTGGCAGG + Intergenic
928312918 2:30225154-30225176 CAGCTATCTGATCCTGAGGCTGG + Intergenic
931877063 2:66525352-66525374 CAGCAAGCTCCTATTGCTGCTGG + Intronic
933604594 2:84369028-84369050 CAGCCAGCTCAGATTGCAGCTGG - Intergenic
933759450 2:85663835-85663857 CAGCTAGCGCACCCTGGGGCGGG + Exonic
1169214673 20:3786271-3786293 CAGCTTGTTGGTCTTGCGGCAGG + Exonic
1176098831 20:63355994-63356016 CTCCGAGCTCATCTGGCGGCCGG - Exonic
1184078713 22:42202133-42202155 CAGCTAGCTCATCTTGCCAGGGG - Intronic
977470747 4:97438475-97438497 CAGCTCCCTCAGCTTGCGGCAGG - Intronic
984196626 4:176665203-176665225 CAGCTAACTCATGTGGCTGCTGG + Intergenic
990606829 5:57418941-57418963 CATCTAGCTCATGTTTCTGCTGG - Intergenic
997833403 5:137172467-137172489 CAGAGAGCTCATCTTCCTGCAGG - Intronic
1015192223 6:130484212-130484234 CAGCATGCTCATCTTGCAGGAGG - Intergenic
1017797273 6:157857212-157857234 CAGCAAGCTCATCTTCAGGTTGG + Intronic
1017951134 6:159136336-159136358 CAGCAAGCTCTTATTGTGGCTGG + Intergenic
1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG + Intergenic
1035633542 8:1126892-1126914 CAGCCAGCTCCTCCTGAGGCAGG + Intergenic
1036411645 8:8507064-8507086 CAGCAAGGTCATCTTGGGCCTGG - Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1045016689 8:98006830-98006852 CAGCTAGCTACTCTGGAGGCTGG + Intronic
1046770331 8:118111549-118111571 CGGCTAGTGCATCTTGCAGCTGG + Exonic
1047692157 8:127366841-127366863 CATTTAGCTCATTTTGAGGCTGG - Intergenic
1048619402 8:136115217-136115239 CAGCAAGCTCCTCTTTCGGAAGG + Intergenic
1049435893 8:142586101-142586123 CAGTTAGCTCATCTAAGGGCAGG - Intergenic
1051191515 9:14517907-14517929 CACCTAACTCATCTTGAAGCTGG - Intergenic
1057305870 9:93911641-93911663 GAGCCAGCCCATCTGGCGGCAGG - Intergenic
1060240206 9:121896742-121896764 CAGCCTGTTCCTCTTGCGGCGGG - Intronic
1061972659 9:134053361-134053383 CAGCTGGTTGGTCTTGCGGCCGG + Exonic
1062272183 9:135714615-135714637 CAGGTCGCTCATCTTGAAGCCGG - Exonic
1190377119 X:49799146-49799168 CAACTAGGTCATCTTGGGGATGG - Intergenic
1202202362 Y:22367105-22367127 CAGGCAGCTCCACTTGCGGCCGG - Intronic