ID: 1167748880

View in Genome Browser
Species Human (GRCh38)
Location 19:51368216-51368238
Sequence ACCAGGACGGGGAGGGGGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167748869_1167748880 -5 Left 1167748869 19:51368198-51368220 CCTGCGGTTACTGCCGCTACCAG 0: 1
1: 0
2: 0
3: 4
4: 30
Right 1167748880 19:51368216-51368238 ACCAGGACGGGGAGGGGGTCGGG 0: 1
1: 0
2: 4
3: 40
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167748880 Original CRISPR ACCAGGACGGGGAGGGGGTC GGG Intronic
900312906 1:2043056-2043078 GGCAGGACGGGGAGGAGCTCAGG + Intergenic
900366095 1:2312574-2312596 GCCAGGATGGGGTCGGGGTCTGG - Intergenic
900552057 1:3261766-3261788 ACCAGGACGGAGGGCGGGGCAGG - Intronic
900614012 1:3556218-3556240 CCCAGGATGGGGAGTGGGGCAGG + Intronic
900786230 1:4652641-4652663 AGCAGGGCAGGGAGGGGCTCCGG - Intergenic
901069306 1:6509297-6509319 ACCAGGACAGGCAGAGGGACAGG + Intronic
901235287 1:7664374-7664396 AGAAGCTCGGGGAGGGGGTCTGG - Exonic
901430512 1:9211306-9211328 CCCAAGACGGGGAGGCGGTGGGG - Intergenic
901754428 1:11432740-11432762 ACCAGGAGTGGGAGGAGGCCAGG - Intergenic
902815954 1:18916968-18916990 AGCAGGACGGGGAGGTGAACCGG - Exonic
903034899 1:20486787-20486809 TCCAGGAGGGGGAGGGGGAGAGG + Intergenic
903360769 1:22775717-22775739 TCCAGGAAGGAGAGGGGGTGTGG + Intronic
903461057 1:23521339-23521361 ACCAGGCAGGGGAGGGAGTCAGG - Intronic
903654877 1:24943010-24943032 CTCAGGACTGGGCGGGGGTCCGG + Intronic
903677371 1:25072804-25072826 ACCAGGATGGGCAGAGGGGCAGG - Intergenic
903679796 1:25089236-25089258 AGCAGGATGGGGAGGGGCTTTGG + Intergenic
903846007 1:26280286-26280308 CCCAGGACGGGGGCGGGGTGGGG + Intronic
904484152 1:30813927-30813949 ACCAGGATGAGGATGGGGACAGG + Intergenic
904770092 1:32876256-32876278 AGGAGGACGGGGAGGGGGGAAGG + Intergenic
905010838 1:34746095-34746117 AGCAGGACTGAGAGGGGCTCTGG - Intronic
905263185 1:36733415-36733437 AACAGGATGGGTAGGGGGTAGGG + Intergenic
905934335 1:41811682-41811704 AGCACCACGGGGAGGGGGTGGGG + Intronic
907167916 1:52431205-52431227 GCCAGGACGGGGCAGGGATCTGG + Exonic
907265192 1:53254975-53254997 ATCAGGACTGGGAGGTGGGCAGG + Intronic
907296556 1:53459706-53459728 GCCGGGACGGGGACGGGGGCGGG - Exonic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
908738928 1:67307743-67307765 ATCGGGCCGGGGCGGGGGTCGGG - Exonic
912355751 1:109053330-109053352 TCCCGGACGGGGTGGCGGTCGGG - Intergenic
912844000 1:113063529-113063551 TCCTGGACGGGGAGGCGGCCGGG + Intergenic
913248115 1:116888131-116888153 AAGGGGAAGGGGAGGGGGTCAGG + Intergenic
913269243 1:117076725-117076747 ACCACGACGAGGAAGGGGTTGGG - Exonic
913386022 1:118259189-118259211 TCCAGGACGGGTGGGGGTTCTGG + Intergenic
914082214 1:144419452-144419474 ATCCGGTCGGGGAGGTGGTCTGG - Intergenic
914677926 1:149917944-149917966 AAGAGGATGGGGAGGGAGTCAGG + Intergenic
914772117 1:150697064-150697086 ACTAGGACGGGGGTGGGGTGGGG - Intronic
915214540 1:154331056-154331078 ACCAGGACAGGGAAGAGATCTGG - Exonic
915864834 1:159487857-159487879 AACAGGACGGGGATGGGATGGGG + Intergenic
916461485 1:165029262-165029284 TCCAGGAAGGGGAGAGGGGCTGG + Intergenic
917535028 1:175868294-175868316 AGGAGGATGGGCAGGGGGTCAGG - Intergenic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
918684328 1:187396703-187396725 CCCAGGAAGGGCAAGGGGTCGGG + Intergenic
919935654 1:202248908-202248930 CCCAGGATAGGGAGGGGGCCAGG - Intronic
921960956 1:221033952-221033974 AGCTGGAGGTGGAGGGGGTCAGG + Intergenic
922885831 1:229019828-229019850 GGCAGGACGGGGAAGGGGTCAGG - Intergenic
923046857 1:230362026-230362048 AGCAGGAAGGGGAGTGGGTGGGG + Intronic
924564497 1:245185430-245185452 ACAAGGAAGGGAGGGGGGTCTGG + Intronic
1064052315 10:12069183-12069205 CCCAGGTCGGGGATGGGGCCCGG + Exonic
1064239063 10:13608365-13608387 AGCAGGTCGGGGAGCGGGCCTGG - Intronic
1065367855 10:24952666-24952688 ACGGGGACGGGGACGGGGACGGG + Intergenic
1065367858 10:24952672-24952694 ACGGGGACGGGGACGGGGACGGG + Intergenic
1065367861 10:24952678-24952700 ACGGGGACGGGGACGGGGACGGG + Intergenic
1067232495 10:44421888-44421910 ACCAGAACAGGGAGGGGCTGAGG + Intergenic
1068357182 10:55923771-55923793 ACCAGGAAGCTGAAGGGGTCAGG - Intergenic
1069374172 10:67776985-67777007 AACAGGACACGGAGTGGGTCTGG + Intergenic
1069705541 10:70457007-70457029 AGCAGGCAGGGGAGGGGGGCAGG - Intergenic
1070756406 10:78996157-78996179 AGCAGGAGGGGGGAGGGGTCGGG - Intergenic
1071339045 10:84625791-84625813 AACAGGGCGGGGGGGGGGGCGGG - Intergenic
1073177731 10:101566670-101566692 ACCGGCACGGGGTGGGGGTGGGG - Intergenic
1073322855 10:102626141-102626163 ACAAGGACAGGGAGGGGGAGGGG + Intronic
1074017259 10:109546476-109546498 CCCAGGAAGTGGAAGGGGTCAGG + Intergenic
1074283251 10:112073318-112073340 ACCAGGGCAGGGAAGGGGTATGG - Intergenic
1075429556 10:122369117-122369139 GCCAGGAGAGGGTGGGGGTCAGG + Intergenic
1076076239 10:127535958-127535980 ACCAGGACGGGGGCAGTGTCTGG - Intergenic
1076800784 10:132827130-132827152 CCCAGGACTGGGTGGGGCTCAGG - Intronic
1077080234 11:721751-721773 ACAGGGACGGGGACGGGGCCAGG + Intronic
1077524152 11:3054162-3054184 ATCAGGACGGGGAGTGGGAGGGG - Intronic
1077593354 11:3510060-3510082 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
1078276075 11:9848082-9848104 GCCAGGGTGGGGAGGGGGTGGGG + Intronic
1079055998 11:17207497-17207519 ACAAGGCGGGGGAGGGGGGCCGG + Intronic
1079332202 11:19542872-19542894 CCCAGGAAGGGGAGGGTTTCAGG - Intronic
1081814493 11:45930906-45930928 ACCTGGGCGGGGAGGGGGGGGGG - Intronic
1083638977 11:64135297-64135319 GCCAGGACCGGGAGGGGGCCTGG - Intronic
1083658679 11:64242156-64242178 AGCAGCGGGGGGAGGGGGTCAGG - Exonic
1083696629 11:64447805-64447827 GCCAGGAAGGGGAGGGGGAAAGG - Intergenic
1083962104 11:66020384-66020406 ACCAGGCTGGGGAGAGGGACAGG + Exonic
1084249181 11:67882775-67882797 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1084397128 11:68919190-68919212 CACAGGACGGGGACGGGGACGGG - Intronic
1084823629 11:71712694-71712716 ACTAGGATGGGGAGGGGTTCTGG - Intergenic
1084930812 11:72554113-72554135 ACCAACACGGTGAGTGGGTCAGG - Intergenic
1085011012 11:73141924-73141946 ACCAGGAGGAGGAGGAGGGCCGG + Exonic
1085016115 11:73175048-73175070 TCCTGGACTGGGCGGGGGTCAGG - Intergenic
1086308551 11:85509473-85509495 ACCAGGACGGTGGAGGGCTCTGG + Intronic
1086341526 11:85853057-85853079 TCCCGGACGGGGAGGCGGCCGGG - Intergenic
1086757606 11:90583391-90583413 CCCAGGAAGTGGAAGGGGTCAGG - Intergenic
1088907596 11:114166249-114166271 ACCATGAGGGAGAGGGGGCCTGG + Intronic
1089083653 11:115798607-115798629 ACCAGGAAGAGGAGGAGGACGGG - Intergenic
1090175629 11:124646569-124646591 ACCAAGTTGGGGAGGGGGTGGGG + Intronic
1090381819 11:126332682-126332704 ACCAGGCTGGGGAAGGGGGCTGG - Intronic
1090394261 11:126408416-126408438 ACCAGGACGAGGAGTGTGTCTGG - Exonic
1090662008 11:128889647-128889669 GCCATTACGGGGTGGGGGTCAGG - Intergenic
1090758579 11:129816026-129816048 ACGCGGACAGGGAGGGGCTCTGG + Intronic
1091138584 11:133215988-133216010 ACCAGGAGGGGGTGGGAGGCAGG + Intronic
1091460569 12:641310-641332 AGCAGGAGGTGGAGGGGGTTGGG - Intronic
1091634513 12:2186987-2187009 AGCAGGACAGGAAAGGGGTCGGG - Intronic
1091823193 12:3491361-3491383 AGAGGGGCGGGGAGGGGGTCGGG + Exonic
1092275887 12:7060732-7060754 ACCAGGACAGGGAGGCTGGCCGG + Intronic
1092419472 12:8318202-8318224 AGTAGGATTGGGAGGGGGTCTGG + Intergenic
1092462420 12:8698179-8698201 GAGAGGAGGGGGAGGGGGTCGGG - Exonic
1095128279 12:38508058-38508080 CCCAGGAAGGGCAAGGGGTCGGG + Intergenic
1097194511 12:57236192-57236214 ACCCGGCCGCGGAGAGGGTCCGG - Intronic
1098216941 12:68230684-68230706 AGGAGGACGGGGAGGATGTCAGG + Intergenic
1100094217 12:91011434-91011456 ACCTTGATGTGGAGGGGGTCAGG - Intergenic
1103024442 12:117562257-117562279 ATGAGGAAGGGGAGGGGGTGGGG + Intronic
1104748940 12:131226455-131226477 GCCGGGACAGGGATGGGGTCAGG + Intergenic
1104787785 12:131460814-131460836 GGCAGGAAGGGGAGGGGGTCAGG + Intergenic
1104861989 12:131928868-131928890 ACGGGGACGGGGAGCGGGGCTGG + Intergenic
1104892840 12:132148666-132148688 GCCAGGCCGGGGAGGGGGCGGGG + Intronic
1104904974 12:132208286-132208308 GCCAGGAAGGGGAGGGGCCCGGG - Intronic
1104916433 12:132267219-132267241 ACCAGGGCGGGGAAGGAGGCAGG + Intronic
1105513097 13:21067412-21067434 TCCAGGAAGGGGAGAGGGGCTGG + Intergenic
1108422660 13:50266653-50266675 ACAGGGCAGGGGAGGGGGTCGGG - Intronic
1108607247 13:52052092-52052114 AGCAGGGCGGGGGTGGGGTCGGG - Intronic
1108703301 13:52962154-52962176 ACCATGGGAGGGAGGGGGTCTGG + Intergenic
1109775727 13:67038984-67039006 ACCAGGGAGGAGAGGGGGTCAGG + Intronic
1111951143 13:94710763-94710785 ACACGGACCGGGAGGGGGTTGGG + Exonic
1114483175 14:23047856-23047878 ACAAGGACAGGGAGGAGGCCTGG + Exonic
1116515138 14:45795962-45795984 ACCAGGAAGCGCAAGGGGTCAGG + Intergenic
1118308388 14:64674898-64674920 ATCAGGTCGGTGAGGGGGTAAGG + Intergenic
1119766027 14:77188082-77188104 ACCAGGACTGGGATGGGGAGAGG - Intronic
1119970371 14:78963464-78963486 ACCAGGAAGGGGAGCTGGGCTGG - Intronic
1121649857 14:95549996-95550018 ACAGAGACTGGGAGGGGGTCAGG + Intergenic
1121741672 14:96257187-96257209 CCCAGGACGGGGAGGTGGCTGGG - Intronic
1121780180 14:96617255-96617277 ACCAGGGTGGGGAGGGGCTGAGG + Intergenic
1122053790 14:99078609-99078631 AGCAGGGCCTGGAGGGGGTCCGG - Intergenic
1122622653 14:103068638-103068660 AGCAGGATGGAGAGTGGGTCTGG - Intergenic
1122645280 14:103189631-103189653 GCGAGGACGGGGAGCGGGTGGGG - Intergenic
1122782636 14:104150133-104150155 AGGAGGAGGGGGAGGGGGACGGG - Intronic
1124341396 15:28891536-28891558 ACAGGGATGGGGAGAGGGTCTGG + Intronic
1124377065 15:29135112-29135134 ACCAGGGAGGGGCGGGGGTAGGG - Intronic
1124600190 15:31127532-31127554 CCCAGGACAGGGAGGTGGTGAGG + Intronic
1125338508 15:38651912-38651934 ACCTGGAGGGGAAGGGGGTGTGG - Intergenic
1125439754 15:39689379-39689401 TCCAGGGAGGGGAGAGGGTCTGG - Intronic
1125509104 15:40283277-40283299 CCCACGAAGGGGTGGGGGTCAGG - Intronic
1127384443 15:58455975-58455997 CCAAGGAAGGGAAGGGGGTCAGG + Intronic
1127836703 15:62796305-62796327 TCCTGGACGGGGAGAGGTTCAGG + Intronic
1128544158 15:68556096-68556118 GACAGGACGGGGAGCGGGCCAGG + Intergenic
1128551029 15:68598072-68598094 TCCAGGTGGTGGAGGGGGTCTGG - Intronic
1129289305 15:74551508-74551530 ACCTGGAAGGGGATGGGATCTGG - Intronic
1129440823 15:75579519-75579541 ACCGGGAGGGGGAGGGGACCCGG + Intergenic
1130010835 15:80152470-80152492 ATCAGGACGGGGGCGGGGCCAGG + Intronic
1130551229 15:84891048-84891070 CCCAGGATGGGGAGTGGGTAGGG + Intronic
1131080091 15:89527298-89527320 ACCTTGCCGGGGAGGGGGGCAGG - Intergenic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132482224 16:172484-172506 GCCAGGCCGGGGCGGGGGTGCGG + Intergenic
1132483072 16:176288-176310 GCCAGGCCGGGGCGGGGGTGCGG + Intergenic
1132576814 16:668150-668172 ACCAGGTCGGGGCCGGGTTCCGG + Exonic
1132594333 16:741276-741298 ACAAGGAAGCGGAGGGGATCTGG + Intronic
1132614225 16:832292-832314 AGCAAGACGGGGAGGGGCTTGGG + Intergenic
1132757596 16:1493601-1493623 TCCAGGTCGGGTTGGGGGTCGGG + Exonic
1132824829 16:1899101-1899123 ACCAGTGCTGGGAGGGGTTCTGG - Intergenic
1132891137 16:2205462-2205484 TCCAGGACGGCGAGGGGAGCCGG - Exonic
1133156660 16:3880751-3880773 GCCTGAACGGGGAGGGGGTGGGG + Intergenic
1133344622 16:5061658-5061680 ACCAGGCCTGGGAGAGGGTGGGG + Intronic
1133464699 16:6018817-6018839 ACCAGGACGAGGACGGGCGCAGG + Intergenic
1133890921 16:9877817-9877839 AGCAGGACAGGGAGGGGGGATGG - Intronic
1134069774 16:11253919-11253941 TCCAGGAAGGGGTGGGGGTGGGG - Intronic
1134122820 16:11596764-11596786 AGGAGGAGGGGGAGGGGGACAGG + Intronic
1135303604 16:21350800-21350822 ACCAGGGCGGGGAGCAGGTAGGG + Intergenic
1135631035 16:24035655-24035677 CCAGGGACGGGGAGGGGGTGTGG + Intronic
1136077369 16:27826377-27826399 ACGAGGACGAGGAAGGGGACAGG - Intronic
1136300350 16:29329995-29330017 ACCAGGGCGGGGAGCAGGTAGGG + Intergenic
1136718124 16:32301253-32301275 ACAGGGACAGGGAGAGGGTCAGG + Intergenic
1136723103 16:32339524-32339546 GCCAGGACAGGGACAGGGTCAGG + Intergenic
1136836499 16:33507523-33507545 ACAGGGACAGGGAGAGGGTCAGG + Intergenic
1137376063 16:47952845-47952867 AGCAGTAGGGTGAGGGGGTCAGG + Intergenic
1137525090 16:49228280-49228302 CCCAGGAAGTGGAAGGGGTCGGG + Intergenic
1137603880 16:49774402-49774424 ACCAGGAGGGGGAGGTGGGCAGG + Intronic
1138219913 16:55241746-55241768 AGCAGGATGGGGAGGTGGTGGGG + Intergenic
1138577693 16:57919019-57919041 AGCGGGATGGGGAGAGGGTCAGG - Intronic
1138577908 16:57920339-57920361 ACCTGGATGGGGATGGGGTGGGG - Intronic
1139523523 16:67499152-67499174 GCCAGGTTGGGGAGGGAGTCTGG - Intergenic
1139550121 16:67668260-67668282 ACCAGGCAGGGAAGGGGGACGGG + Exonic
1139953860 16:70684362-70684384 ACCATGAGGGGCAGGGGGTGGGG + Intronic
1140304949 16:73794290-73794312 AGAAGGGCTGGGAGGGGGTCTGG - Intergenic
1141464442 16:84196775-84196797 ACCGGGACGGGGGGAGGGTGGGG - Intronic
1141610265 16:85177171-85177193 AGCAGGAGGGGGAAGGGGTGAGG + Intronic
1141626635 16:85264813-85264835 ACCAGGACCGGGAGGGGTGAGGG + Intergenic
1141886730 16:86897383-86897405 ACCAGGCCTGGGTGGGGGTTGGG + Intergenic
1203003328 16_KI270728v1_random:178240-178262 GCCAGGACAGGGACAGGGTCAGG - Intergenic
1203008304 16_KI270728v1_random:216512-216534 ACAGGGACAGGGAGAGGGTCAGG - Intergenic
1203134936 16_KI270728v1_random:1714647-1714669 GCCAGGACAGGGACAGGGTCAGG - Intergenic
1203146684 16_KI270728v1_random:1807824-1807846 ACAGGGACAGGGAGAGGGTCAGG + Intergenic
1142603633 17:1069924-1069946 ACGGGGCGGGGGAGGGGGTCCGG - Intronic
1142763925 17:2055651-2055673 GCCAGGAGGGGAACGGGGTCGGG + Intronic
1143861915 17:9897370-9897392 ACGAGGCGGGGGACGGGGTCGGG - Exonic
1144670478 17:17129993-17130015 ACCAGGGAGGAGAGGGGCTCAGG + Intronic
1146726659 17:35161823-35161845 TCCAGGAAGGGGAGAGGGGCTGG + Intronic
1147267584 17:39244261-39244283 AGCAGGAGGAGGAGGGGGCCAGG - Intergenic
1147652679 17:42071377-42071399 ACCAGGGAGGGGAGGCGGTGGGG - Intergenic
1147910504 17:43853324-43853346 ACCAGGAAGGGCAGGGTGGCAGG - Intronic
1148106937 17:45123952-45123974 ACCTGGTTGGGGGGGGGGTCTGG - Intronic
1149607278 17:57933940-57933962 AGCAGGATGGGGAGGGGAGCAGG - Intronic
1150423023 17:65056034-65056056 ACCAGGACGCGGTGGGGGGTGGG + Intronic
1150427172 17:65086108-65086130 ACAAGGAGGGGCTGGGGGTCTGG + Intergenic
1150596492 17:66610401-66610423 TCCAGGAAGGGGTGAGGGTCTGG - Intronic
1151560597 17:74867588-74867610 AGCAGGACAGGGAGGGGGCACGG + Intronic
1151658260 17:75505745-75505767 ACCAGGATGTGGAGGGGGAGTGG - Intronic
1151983125 17:77526131-77526153 ACCAGGAGGGGGTGGGGGGTGGG + Intergenic
1152031264 17:77844978-77845000 ACCAGCACAGGGTGGTGGTCGGG - Intergenic
1152562327 17:81084792-81084814 AGAAGGAAGGGGAGGGAGTCAGG - Intronic
1152606087 17:81291116-81291138 AGCTGGACGGTGAGGGGGGCGGG + Intronic
1152700049 17:81814196-81814218 ACCAGGATGGGAAGGTGGCCAGG - Intergenic
1152804126 17:82347098-82347120 AGCAGGGCGGGGACCGGGTCGGG - Intergenic
1153301608 18:3596758-3596780 ATCAGGAAGGGGAGGTGATCGGG + Intronic
1156077087 18:33292414-33292436 ACTAGGAAGGGTAGGGGGTAGGG + Intronic
1157609662 18:48948743-48948765 CCGAGGACGGGGAGGGGGCATGG - Intronic
1159941391 18:74411682-74411704 GCCAGGGCGGGGAGGGGGATGGG - Intergenic
1160151586 18:76399117-76399139 ACCAGCACCAGGAGGGAGTCGGG - Intronic
1160408961 18:78661696-78661718 AGCAGGAAGAGGAGGGAGTCTGG + Intergenic
1160500843 18:79400537-79400559 ACGAGGACGCGGAGGGGGCCTGG - Intronic
1160726728 19:620836-620858 AGCAGGACGGGCAGGGGGCGCGG + Intronic
1160768994 19:821971-821993 GCCGGGAAGGGGAGGGGGACGGG + Intronic
1160843428 19:1156348-1156370 ACCTGGACCGGGAGGGGATGGGG + Intronic
1161027345 19:2042682-2042704 ACCACGACGGGGTGAGGGTCTGG + Intronic
1161220366 19:3115602-3115624 TCCAGGACGGGCCGGGGGCCTGG + Intronic
1161273742 19:3404317-3404339 ACCGGGAGGGGGTGGGGGTGAGG + Intronic
1161320498 19:3638589-3638611 ACAAGGCCGGGGAAGGGGACAGG + Intronic
1161461465 19:4400233-4400255 ACCTGGCCCGGGAGGGGGCCGGG - Intronic
1161483722 19:4523742-4523764 GCCAGGTCGGGCAGGGGCTCGGG + Exonic
1161900552 19:7115921-7115943 GCCGGGAAGGGGAGGGAGTCAGG - Intronic
1161998817 19:7730688-7730710 CTCAGGACGGGGTCGGGGTCGGG + Intronic
1162007356 19:7788951-7788973 CTCAGGACGGGGTCGGGGTCGGG - Intergenic
1162770066 19:12944071-12944093 AAAAGGGCGGGGAGGGGGTGGGG - Exonic
1162798222 19:13097618-13097640 ACCCGGACGGGGATGGGGCGAGG - Intronic
1162925710 19:13929799-13929821 ACCTGGAGGGGGAGGGGCTCGGG + Intronic
1162925724 19:13929829-13929851 ACCTGGAGGGGGAGGGGCTCGGG + Intronic
1162925749 19:13929889-13929911 ACCTGGAGGGGGAGGGGCTCGGG + Intronic
1162925763 19:13929919-13929941 ACCTGGAGGGGGAGGGGCTCGGG + Intronic
1162925777 19:13929949-13929971 ACCTGGAGGGGGAGGGGCTCGGG + Intronic
1164515557 19:28932455-28932477 ACCAGGAGATGGAGGGGGGCAGG - Intergenic
1165154197 19:33777477-33777499 CCCGGGCCGGGGAGGGGGTGTGG + Intergenic
1165172797 19:33905929-33905951 ACCGGATCGGAGAGGGGGTCGGG + Intergenic
1166844423 19:45718037-45718059 ACCAGGATAGGGACGGGTTCAGG - Intronic
1167307748 19:48719051-48719073 ACCTGGACGGAGAGGGGGCAGGG + Exonic
1167648715 19:50718795-50718817 ACCCGGCCGGGGAGAGGGGCGGG + Intronic
1167748880 19:51368216-51368238 ACCAGGACGGGGAGGGGGTCGGG + Intronic
1168245783 19:55112617-55112639 ACCTGGTCGGGGTGGGGGCCTGG - Intronic
1168401502 19:56088248-56088270 CCCAGCACGGGGACGGGCTCGGG - Exonic
924985427 2:265097-265119 ACCATGAGGGGGAGGAGGCCAGG + Intronic
925198013 2:1943100-1943122 AGGAGGACGAGGAGGGGGACCGG - Exonic
925403815 2:3592264-3592286 ACGGGGACGGGGACGGGGACGGG + Intergenic
925403818 2:3592270-3592292 ACGGGGACGGGGACGGGGACGGG + Intergenic
925403821 2:3592276-3592298 ACGGGGACGGGGACGGGGACGGG + Intergenic
925403824 2:3592282-3592304 ACGGGGACGGGGACGGGGACGGG + Intergenic
926982616 2:18587209-18587231 ATCAGGGAGGGGAGGGGGTCTGG - Intronic
927142287 2:20138722-20138744 CCCAGGACGGGGAAGGCGCCCGG + Intergenic
927818917 2:26245075-26245097 CCCAGGGAGGGGAGGGGGCCGGG - Intronic
929078635 2:38099481-38099503 AATAAGATGGGGAGGGGGTCTGG - Intronic
929701751 2:44168731-44168753 AGCAGCACGGGGAGGGGGAGCGG + Intronic
929959867 2:46488327-46488349 ATCAGGAAGGGAAGGGGCTCTGG - Intergenic
930014081 2:46958658-46958680 AGCAGGACAGGGAGGAGGACAGG - Intronic
931194156 2:60035060-60035082 ACCAGGAAGCGCAAGGGGTCAGG + Intergenic
932346571 2:70999614-70999636 AACAGGACAGGGCGGGGCTCAGG + Intergenic
932763550 2:74456143-74456165 ATCAGGAGGGTTAGGGGGTCAGG + Exonic
934461338 2:94214867-94214889 ACCAGGACAGGGACAGGGACAGG - Intergenic
935604764 2:104959554-104959576 CCCAGGAAGGGCAAGGGGTCTGG - Intergenic
935958306 2:108400122-108400144 AGCTGGAAGGGGAGGGGGTAAGG - Intergenic
938068636 2:128294981-128295003 ACCAAGAGGGGGAGGTGGTTTGG - Intronic
938301145 2:130213756-130213778 ACCAGGCCGGGGAGAGGGCGCGG - Intergenic
938322074 2:130372357-130372379 ACGGGGACGGGGACGGGGACGGG + Exonic
946128652 2:217586880-217586902 AAGAGGATGGGGTGGGGGTCAGG - Intronic
946235577 2:218322924-218322946 CCCTGGACGGGGAGGCGGGCGGG + Intronic
946239403 2:218344717-218344739 TCCAGGATGGGGCAGGGGTCGGG + Intronic
946242089 2:218362679-218362701 ACCAGGAAGGGGCAGGGGACAGG - Intronic
946666801 2:222058991-222059013 TCCAGGGCGGGGAGGGGATGAGG + Intergenic
947301216 2:228690098-228690120 ACCAGGACGGGGCAGAGGCCGGG + Intergenic
947330976 2:229029069-229029091 ACCAGGAGGGGGAGGGTTGCGGG + Intronic
948163802 2:235845598-235845620 AGCAGATCGGGGGGGGGGTCAGG - Intronic
948453662 2:238093967-238093989 ACCAGGAGGGGGAGGGTGCGTGG + Intronic
948545398 2:238725035-238725057 AGGAGGACGGGGCGGGAGTCAGG + Intergenic
948623147 2:239249307-239249329 CCCAGGGCGGGGAGGGGCTGCGG + Intronic
948884114 2:240874477-240874499 GCCAGGCCGGGCAGGGGGTAGGG + Intronic
1169680188 20:8203550-8203572 ACCAGGCCGGGGGTGGGGTGGGG + Intronic
1170940444 20:20844241-20844263 AACAGGACGTGGAGAGGGTGGGG - Intergenic
1171109119 20:22464315-22464337 CCCAGGAAGGGGAGGGAGGCTGG + Intergenic
1172034841 20:32003257-32003279 CCCAGGAGGGGGAGGGGGAGGGG + Exonic
1172705460 20:36879180-36879202 ACCAGGACGGGCAGGTGAGCTGG + Exonic
1172842715 20:37911659-37911681 GCCAGGATGGGGAGAGGGGCTGG + Intronic
1172998815 20:39091000-39091022 ACAAGGAAGGGGAGGGGGACTGG - Intergenic
1173691809 20:44966621-44966643 AAGAGGACGGGCATGGGGTCAGG + Intronic
1173852641 20:46228546-46228568 ACCAGGTGGGGGTGGGGGTAAGG + Intronic
1173962579 20:47086521-47086543 AGCAGGAAAAGGAGGGGGTCAGG + Intronic
1174475815 20:50795063-50795085 ATCAGGAGGGCGACGGGGTCCGG - Exonic
1175141018 20:56860220-56860242 ACGAGGAGGGGGATGGGGACGGG - Intergenic
1175156937 20:56977556-56977578 ACCAGGCCTGGGATGAGGTCAGG + Intergenic
1175904996 20:62375308-62375330 GCCAGGAGGGGGAGGGGGAGGGG + Intergenic
1175911336 20:62406852-62406874 ACAGGGACGGGGACGGGGGCCGG - Intronic
1176128887 20:63487949-63487971 ACTTGGGCAGGGAGGGGGTCCGG + Intergenic
1176296642 21:5076667-5076689 ACCAGGAGGAGGAGGGGCGCTGG + Intergenic
1176301943 21:5102652-5102674 ATCCGGAGGGGAAGGGGGTCTGG + Intergenic
1179099917 21:38347401-38347423 ATCAGGACGGACAGGAGGTCGGG + Intergenic
1179479932 21:41670539-41670561 AACAGGAGGTGGAGGGGGACAGG + Intergenic
1179583246 21:42358360-42358382 ACCAGGAGGTGGAGGGAGCCTGG + Intergenic
1179598038 21:42456239-42456261 ACCAGGGTGGGGTGGGGGTGGGG + Intergenic
1179855087 21:44159248-44159270 ATCCGGAGGGGAAGGGGGTCTGG - Intergenic
1179860407 21:44185454-44185476 ACCAGGAGGAGGAGGGGCGCTGG - Intergenic
1179976876 21:44873427-44873449 TCCAGGTCGGGGTCGGGGTCGGG - Intronic
1180258676 21:46651318-46651340 ACCAGGACTGGCTGGGGGCCGGG + Intronic
1180515693 22:16140941-16140963 AGAAGGACTGGGAGGGGGTGGGG + Intergenic
1180720351 22:17903261-17903283 ACCAGGAATGGGAGGGGGAATGG - Intronic
1181083881 22:20430398-20430420 CCCGGGACCGGGAGGGGGTTGGG - Intronic
1182117724 22:27766811-27766833 TTCGGGACGAGGAGGGGGTCTGG - Intronic
1182586248 22:31345856-31345878 ACCGGGAAGGGGAGGCGGGCGGG - Exonic
1182796371 22:32994294-32994316 GCCAGGACTGCGAGGGGGTAGGG + Intronic
1183414502 22:37674866-37674888 ACCAGGAGGGGGTGGGGTCCTGG - Intergenic
1183604232 22:38859369-38859391 ACAAGGAAGGGGTGGGGGCCAGG + Intergenic
1183672991 22:39283782-39283804 ACCAGGTCAGGGAGGGGGTTGGG - Intergenic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1184451896 22:44587457-44587479 ACCACGATGGGGAGGGTGGCCGG - Intergenic
1184979668 22:48086854-48086876 CCCGGGTCGGGGCGGGGGTCGGG + Intergenic
1184979682 22:48086878-48086900 CCCGGGTCGGGGCGGGGGTCGGG + Intergenic
1184979696 22:48086902-48086924 CCCGGGTCGGGGTGGGGGTCGGG + Intergenic
1184979723 22:48086949-48086971 CCCGGGTCGGGGTGGGGGTCGGG + Intergenic
1185112439 22:48908120-48908142 AGCACCACGGGGAGGGGGTTAGG + Intergenic
1185151732 22:49167640-49167662 ACGGGGGCGGGGAGGGGGTGTGG + Intergenic
1185180269 22:49355898-49355920 ACCAGGGCTGAGATGGGGTCAGG - Intergenic
1185219074 22:49620089-49620111 AGGGGGACGGGGAGGGGGTTGGG - Intronic
1185285470 22:49997949-49997971 ATCAGGGCGGGGAGTGGGGCAGG - Intronic
1185376732 22:50486118-50486140 GCGAGGATGGGGATGGGGTCAGG - Exonic
950191259 3:10978013-10978035 ACCAGGATCGGGAGGGCGTGCGG - Intergenic
950264914 3:11566535-11566557 ATGAGGACGGGAAGGTGGTCAGG - Intronic
950502867 3:13375707-13375729 CCCAGGGAGGGGTGGGGGTCCGG - Intronic
950574231 3:13821770-13821792 CCCAGGGCGGGGAGGGGCTGTGG + Intronic
951491467 3:23274325-23274347 TCCAGGAAAGGAAGGGGGTCGGG - Intronic
953006345 3:38982733-38982755 TCAAGGATGGGGTGGGGGTCAGG + Intergenic
953653968 3:44833273-44833295 ACCAGGAGTGTGAGGGGGGCTGG + Intronic
954004071 3:47578431-47578453 CCCAGGAGGTGGTGGGGGTCCGG - Intronic
954392724 3:50275935-50275957 GACAGGGCGGGGAGTGGGTCTGG - Intronic
954785191 3:53087443-53087465 ACCTGGAGGAGGAGGGGCTCAGG - Intronic
955239437 3:57165871-57165893 TCCAGGAGGGTGAGGGGGACGGG - Intronic
957063451 3:75500957-75500979 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
958618453 3:96526846-96526868 CCCAGGAAGGGCAAGGGGTCAGG + Intergenic
959597311 3:108142632-108142654 ACCCGGTCTGGGAGGGGGCCAGG - Intergenic
961043285 3:123692480-123692502 ATCAGGACTGGGAGGGGGACAGG + Intronic
961289944 3:125838619-125838641 AGTAGGACGGGGAGGGGGTCTGG - Intergenic
961441133 3:126953940-126953962 GCCAGGGCTGGGAGGGGTTCAGG + Intronic
961611683 3:128144678-128144700 ACCAGGAAGGGGAAGAGCTCTGG + Intronic
961897158 3:130177396-130177418 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
962960925 3:140310278-140310300 TTCAGGGCGGGGAGGGGGTGCGG - Intronic
964392694 3:156213932-156213954 ACCAGGGAGGGGAGAGGGGCTGG + Intronic
964685204 3:159387459-159387481 ACCAGGACTGCGGGAGGGTCTGG - Intronic
965200770 3:165655328-165655350 CCCAGGAAGGGCAAGGGGTCGGG + Intergenic
968601965 4:1513682-1513704 ACCAGAACATGGAGGGGGTCTGG + Intergenic
969138542 4:5050514-5050536 ACCAGGTAGGGGACGGGGACTGG + Intergenic
969624851 4:8297203-8297225 AGCAGGACGGGCAGGGAGGCTGG + Intronic
969674771 4:8608495-8608517 CCCAGGACAGGGAGGGGCCCAGG - Intronic
969746276 4:9075104-9075126 AGTAGGATGGGGAGGGGGTCTGG - Intergenic
969805632 4:9606513-9606535 AGTAGGATGGGGAGGGGGTCCGG - Intergenic
971406214 4:26322099-26322121 ACCAGGAGGGGGGCGGGGGCCGG - Intronic
974272701 4:59672968-59672990 ACCTGGATGGGGAAGAGGTCGGG - Intergenic
976370738 4:84285814-84285836 CCCAGGAAGGGCAAGGGGTCAGG + Intergenic
977392603 4:96430901-96430923 ACAAGGTAGGGGAGGGGGTGGGG - Intergenic
978401181 4:108332766-108332788 ACCAGGAAGGGGATAGGATCTGG - Intergenic
978468024 4:109030249-109030271 ACCAGAAGGGGCAGGGAGTCAGG - Intronic
981750726 4:148090666-148090688 ACCAGAACGGAGAGGGGCTGGGG + Intronic
982809855 4:159811661-159811683 AGCAGGACTGGGAGGGGAGCAGG - Intergenic
983632094 4:169859870-169859892 AACAGCACGGGGTGAGGGTCAGG + Intergenic
984701202 4:182819770-182819792 ACCTGGACAGGGAGTGGGGCAGG - Intergenic
984931536 4:184851944-184851966 ACCAGGGTGGGGAGGGGGGCAGG + Intergenic
985967542 5:3349017-3349039 ACCAGGAGGGGCAGGGGCACAGG + Intergenic
986513004 5:8528603-8528625 ACCAGGGCGGGGAGCTGCTCAGG - Intergenic
987311517 5:16685674-16685696 GCAGGGACGGGGAGGGCGTCAGG - Intronic
990394062 5:55357150-55357172 ACCAGGAGGGGTAGGAGGTGTGG - Intronic
990642760 5:57806318-57806340 ACCAGGAAAGTCAGGGGGTCGGG + Intergenic
992378224 5:76210673-76210695 TCCAGGAAGGGGAGAGGGGCTGG - Intronic
993603823 5:89962377-89962399 ACCTGGGCGGGGTGGGGGTGGGG - Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
997643669 5:135466307-135466329 TCCAGGGCGTGGAGGGGGCCGGG - Intergenic
999111925 5:149128873-149128895 CCAAGGACAGGGTGGGGGTCAGG - Intergenic
999184991 5:149700619-149700641 ACTAGGACGGGATGGGGGGCAGG + Intergenic
1000328111 5:160187510-160187532 AACAGCACGGGGTGGGGGTTGGG + Intronic
1001049610 5:168403977-168403999 AGCTGGGTGGGGAGGGGGTCGGG - Intronic
1001949344 5:175805546-175805568 ACCAGGTGAGGGAGGTGGTCTGG - Intronic
1001999491 5:176189686-176189708 GCCTGGGTGGGGAGGGGGTCCGG + Intergenic
1002001660 5:176199606-176199628 AGCAGGACGCGGAGGGGAGCGGG + Intergenic
1002180172 5:177427085-177427107 CCCAGGAAGGGGCGGGGGTCAGG + Intronic
1002189210 5:177470095-177470117 TCCAGGAAGGGGAGGGGCTGAGG - Intronic
1002252678 5:177939377-177939399 AGCAGGACGCGGAGGGGAGCGGG - Intergenic
1002649679 5:180682219-180682241 GCCTGGGTGGGGAGGGGGTCCGG - Intergenic
1002756147 6:162013-162035 ACCAGGACCTGCAGGGGGTGGGG + Intergenic
1003247276 6:4393492-4393514 ACCAGGCCTGGCAGGGGGTGGGG + Intergenic
1004906598 6:20242404-20242426 ACCAGGGAGGGGAGAGGGGCTGG - Intergenic
1005301810 6:24478512-24478534 AGAAGGATGGGGAGTGGGTCTGG - Intronic
1006097699 6:31666173-31666195 ACCAGGACTGGGGTGGGGTAGGG - Exonic
1006401390 6:33819682-33819704 ACCACGATGGGGAGGAGGTTGGG + Intergenic
1006448551 6:34092900-34092922 CCCAGGACAGGGAAGGGGTATGG + Intronic
1006475214 6:34248764-34248786 GCCAGGGTGGGGAGGGCGTCAGG + Intronic
1006514965 6:34540789-34540811 ACCAGGGCTGGGAGTGGGTTGGG + Intronic
1007377849 6:41468684-41468706 CCCAGGAAGTGGAGGGGGTAAGG - Intergenic
1010779496 6:79929157-79929179 ACCAGGTTGGGGAGGGGGGCGGG + Intronic
1012171023 6:96016397-96016419 CCCAAGACGGAGAGGGGTTCAGG - Intronic
1012910461 6:105112113-105112135 AGCAGGCTGGGGTGGGGGTCTGG - Intronic
1013225291 6:108116273-108116295 ACCTGGATGGGGTGGGGGCCTGG + Intronic
1014684085 6:124473285-124473307 ACCAGGAAGGTGAGGTGGCCAGG + Intronic
1014842938 6:126241138-126241160 CCCAGGAAGGGCAAGGGGTCAGG - Intergenic
1015046312 6:128780182-128780204 CCCAGGATGGGCAAGGGGTCGGG - Intergenic
1015545403 6:134356444-134356466 ACCAGGAAATGGAGGGGGTAGGG - Intergenic
1015718721 6:136218262-136218284 ACCAGGATGGCGAAGGAGTCAGG - Intergenic
1017780511 6:157711797-157711819 AGCAGGACTTGGAGGGGGACTGG + Intronic
1018034257 6:159867804-159867826 ACCAGAAGTGGGAGGGGGTGAGG + Intergenic
1019111862 6:169723795-169723817 CCCAGGCCCGGGACGGGGTCAGG + Intronic
1019287366 7:230360-230382 CCCAGGACGGGGTGGGGGGGGGG + Intronic
1019849966 7:3545053-3545075 ACCAGGACTGGGAGGAGAGCTGG + Intronic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1020029020 7:4920127-4920149 CCCATGCCGGGTAGGGGGTCGGG - Intronic
1020327840 7:6989076-6989098 ACTAGGATGGGGAGGGGGTCTGG + Intergenic
1020519661 7:9169653-9169675 CCCAGGACGCACAGGGGGTCGGG - Intergenic
1021154564 7:17194365-17194387 CCCTGGGCAGGGAGGGGGTCAGG - Intergenic
1022126611 7:27363841-27363863 ACCAAGACGGGGTGGGCTTCAGG + Intergenic
1023238933 7:38121580-38121602 ACCAGGACTGGGAGGGACTTGGG + Intergenic
1025206376 7:56995688-56995710 GCCAGGCCGGGGAGGGGGCTGGG + Intergenic
1025940840 7:66075591-66075613 ACCCCGACGGGGAAGGGGCCTGG - Intergenic
1026898749 7:74025830-74025852 TCCAGGACGGGGAGAGAGTCCGG - Intergenic
1026960698 7:74405506-74405528 ACAGGGACTGGGAGGGGGGCCGG - Exonic
1029206179 7:98870355-98870377 TCCAGGGCGGGGAGGGGCTCGGG - Intronic
1029344682 7:99970044-99970066 ACCAGGTGGGGGTGGGGGGCTGG - Intronic
1029436818 7:100568306-100568328 AGCAGGACTGGGAGGGGGAGGGG + Intergenic
1029506633 7:100967022-100967044 ACCAGGGCAGGGAGGGGGCTGGG + Intronic
1029714692 7:102319565-102319587 CCCAGGAGGGGGAGCTGGTCTGG - Intronic
1030005329 7:105112789-105112811 ACCAGGAGGGGGTGGGGGTGGGG - Exonic
1030449743 7:109693068-109693090 CCCAGGAAGGGCAAGGGGTCAGG - Intergenic
1031969746 7:128055466-128055488 ACCTGCACTGGGAGGTGGTCAGG - Intronic
1031995530 7:128227905-128227927 AGCAGGAAGGGGGAGGGGTCAGG + Intergenic
1032016966 7:128386381-128386403 ACCAGGTCTGGGAGGGTGGCAGG + Intergenic
1033253039 7:139777393-139777415 TCCAGGGCGGGGAGAGGGGCCGG - Intronic
1034304537 7:150038757-150038779 GCCAGGAGGGGAAGAGGGTCTGG + Intergenic
1035754962 8:2023957-2023979 GCCAGGAGGGGGAGGCGGCCGGG + Intergenic
1036368777 8:8145022-8145044 AGTAGGATGGGGAGGGGGTCTGG - Intergenic
1036768009 8:11561059-11561081 ACGAGGAGGGGGAGGGGCACAGG + Intronic
1036882112 8:12520620-12520642 AGTAGGATGGGGAGGGGGTCTGG + Intergenic
1037583596 8:20261451-20261473 ACCAGGACGGGGAGGGGCCCGGG + Intronic
1037817315 8:22119031-22119053 GCCTGGACGGGGAGGGGCTCTGG - Exonic
1037941709 8:22956461-22956483 ACCAGGAGGAGGAGGGGGAGGGG - Intronic
1038319629 8:26514675-26514697 ACCAGGTCGGTGTGGGGGTTGGG + Intronic
1039131808 8:34273390-34273412 ACCAAGAAGGGGAGGGGGGAGGG - Intergenic
1041012475 8:53558580-53558602 CCCAGGAAAGGGAGGAGGTCAGG + Intergenic
1042370392 8:67984878-67984900 ACCAGGACGGAGAGGGAGAGGGG + Intronic
1043502697 8:80873487-80873509 GCCAGCCCGGGGAGGGGGACGGG - Intronic
1043621003 8:82192343-82192365 CCCAGGATGTGGAGGGGCTCGGG + Intergenic
1047347839 8:124045775-124045797 TCCAGGTCGGAGAGAGGGTCTGG - Exonic
1047765855 8:127989437-127989459 ACCAGGTCGGGGAGAGGTTATGG - Intergenic
1049237446 8:141519167-141519189 AGCAGGATGGGGAGGGGGCCGGG + Intergenic
1049454301 8:142679163-142679185 AGCAGGACGGAGAGGGGATCTGG + Intronic
1049787769 8:144459246-144459268 ACCAGGCCGCGCAGGTGGTCAGG - Intronic
1049791752 8:144475492-144475514 GCTAGGAAGGGGTGGGGGTCAGG + Intronic
1050552203 9:6758229-6758251 GCCAGGGCGGGGGGAGGGTCCGG + Intronic
1053233809 9:36434304-36434326 AGCAGGAGGGGGAGGGGGATGGG + Intronic
1053691812 9:40590504-40590526 ACCAGGACAGGGACAGGGACAGG - Intergenic
1053732929 9:41074985-41075007 ACAAGGACGGGGAGGGATTTGGG + Intergenic
1054303068 9:63391470-63391492 ACCAGGACAGGGACAGGGACAGG - Intergenic
1054435453 9:65202295-65202317 ACCAGGACAGGGACAGGGACAGG - Intergenic
1054494940 9:65819392-65819414 ACCAGGACAGGGACAGGGACAGG + Intergenic
1054695497 9:68356558-68356580 ACAAGGACGGGGAGGGATTTGGG - Intronic
1057192535 9:93095805-93095827 AGCAGGAAGGGGCGGGGCTCAGG + Intergenic
1057279991 9:93702180-93702202 GTCAGGACTGGGAGGGGGTGGGG + Intergenic
1057478684 9:95426927-95426949 ACCAGGACAGGAAGCGGGGCAGG - Intergenic
1058904873 9:109474497-109474519 ACCAGGGTGGGGTGGGTGTCAGG + Intronic
1059354456 9:113688013-113688035 ACCAGCTGGGGGTGGGGGTCAGG + Intergenic
1059936910 9:119320904-119320926 ACCAGGAGAGGGAGGGGTTATGG + Intronic
1061361432 9:130144816-130144838 CACAGGACGGGGTGGGGGTGGGG - Intergenic
1062264640 9:135681384-135681406 ACCAGGACGGGGCAGGAGGCAGG + Intergenic
1062345589 9:136113163-136113185 CCCAGGCCGGGGAGGGGTTGAGG - Intergenic
1062430210 9:136523558-136523580 TCCAGGTCTGGGAGGGGGGCAGG + Intronic
1062499699 9:136847068-136847090 ATCAGGACGGCGAGGCGGGCCGG + Exonic
1062521761 9:136960806-136960828 GGCAGGAGGTGGAGGGGGTCTGG + Intergenic
1187374548 X:18740064-18740086 CCCAGGAAGGGCAAGGGGTCGGG - Intronic
1192508936 X:71710615-71710637 ACCTGGCGGGGGAGGGGGGCGGG - Intergenic
1192511797 X:71724591-71724613 ACCTGGCGGGGGAGGGGGGCGGG + Intergenic
1192514900 X:71756914-71756936 ACCTGGCGGGGGAGGGGGGCGGG - Intergenic
1192517761 X:71770938-71770960 ACCTGGCGGGGGAGGGGGGCGGG + Intergenic
1192922323 X:75719838-75719860 CCCAGGAAGTGCAGGGGGTCAGG - Intergenic
1194529240 X:95024428-95024450 ACCAGGGGTGGGAGGGGGTTGGG - Intergenic
1194983573 X:100465878-100465900 ACCAGGCAGGGGAAAGGGTCAGG - Intergenic
1196031122 X:111096510-111096532 AACAGGACAGGAGGGGGGTCCGG - Intronic
1197988291 X:132290408-132290430 CCCAGGAAGGGCAAGGGGTCAGG - Intergenic
1198321506 X:135521922-135521944 AGCAGGAAGGGGAGGGGACCAGG - Intronic
1198581788 X:138073607-138073629 CCCAGGACGTGCAAGGGGTCAGG + Intergenic
1199976445 X:152897597-152897619 ACAGGGGCGGGGAGGGGGGCGGG - Intergenic
1200108483 X:153726955-153726977 ACGAGGAAGGGGAGGGGCTGAGG - Intronic
1200126045 X:153815637-153815659 TCCAGGTCGGGGAGGGGACCTGG + Intronic
1200256729 X:154586298-154586320 ACCAGGACAGGGATGGGGCCTGG + Intronic
1200261040 X:154618105-154618127 ACCAGGACAGGGATGGGGCCTGG - Intronic
1200663838 Y:5995771-5995793 AACAGAACAGGGAGGGGGTAGGG - Intergenic
1200763535 Y:7061853-7061875 ACAAGGCAGGGGAGGGGGTGGGG - Intronic