ID: 1167749945

View in Genome Browser
Species Human (GRCh38)
Location 19:51373357-51373379
Sequence GCTGGAGCCCCCACCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167749945_1167749953 5 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749953 19:51373385-51373407 GGCCTTTATCACCAGGATCGGGG No data
1167749945_1167749958 14 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749958 19:51373394-51373416 CACCAGGATCGGGGGGCCTAGGG No data
1167749945_1167749956 7 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749956 19:51373387-51373409 CCTTTATCACCAGGATCGGGGGG No data
1167749945_1167749965 25 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749965 19:51373405-51373427 GGGGGCCTAGGGGGTGTTGGGGG No data
1167749945_1167749949 -2 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749949 19:51373378-51373400 GCCTGGTGGCCTTTATCACCAGG No data
1167749945_1167749959 15 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749959 19:51373395-51373417 ACCAGGATCGGGGGGCCTAGGGG No data
1167749945_1167749952 4 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749952 19:51373384-51373406 TGGCCTTTATCACCAGGATCGGG No data
1167749945_1167749963 23 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749963 19:51373403-51373425 CGGGGGGCCTAGGGGGTGTTGGG No data
1167749945_1167749951 3 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749951 19:51373383-51373405 GTGGCCTTTATCACCAGGATCGG No data
1167749945_1167749962 22 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749962 19:51373402-51373424 TCGGGGGGCCTAGGGGGTGTTGG No data
1167749945_1167749954 6 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749954 19:51373386-51373408 GCCTTTATCACCAGGATCGGGGG No data
1167749945_1167749964 24 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749964 19:51373404-51373426 GGGGGGCCTAGGGGGTGTTGGGG No data
1167749945_1167749961 16 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749961 19:51373396-51373418 CCAGGATCGGGGGGCCTAGGGGG No data
1167749945_1167749957 13 Left 1167749945 19:51373357-51373379 CCTGCTTGGGTGGGGGCTCCAGC No data
Right 1167749957 19:51373393-51373415 TCACCAGGATCGGGGGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167749945 Original CRISPR GCTGGAGCCCCCACCCAAGC AGG (reversed) Intergenic
No off target data available for this crispr