ID: 1167751082

View in Genome Browser
Species Human (GRCh38)
Location 19:51380575-51380597
Sequence GCGGCGGCCCAGGAAGCTGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 297
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 273}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167751069_1167751082 20 Left 1167751069 19:51380532-51380554 CCCAGCCCAGGATGTAGGACCAG 0: 1
1: 0
2: 1
3: 21
4: 229
Right 1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG 0: 1
1: 0
2: 0
3: 23
4: 273
1167751070_1167751082 19 Left 1167751070 19:51380533-51380555 CCAGCCCAGGATGTAGGACCAGG 0: 1
1: 0
2: 2
3: 30
4: 175
Right 1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG 0: 1
1: 0
2: 0
3: 23
4: 273
1167751068_1167751082 23 Left 1167751068 19:51380529-51380551 CCACCCAGCCCAGGATGTAGGAC 0: 1
1: 0
2: 0
3: 28
4: 229
Right 1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG 0: 1
1: 0
2: 0
3: 23
4: 273
1167751073_1167751082 14 Left 1167751073 19:51380538-51380560 CCAGGATGTAGGACCAGGAAAAG 0: 1
1: 0
2: 5
3: 24
4: 276
Right 1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG 0: 1
1: 0
2: 0
3: 23
4: 273
1167751072_1167751082 15 Left 1167751072 19:51380537-51380559 CCCAGGATGTAGGACCAGGAAAA 0: 1
1: 0
2: 0
3: 24
4: 232
Right 1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG 0: 1
1: 0
2: 0
3: 23
4: 273
1167751074_1167751082 1 Left 1167751074 19:51380551-51380573 CCAGGAAAAGCGCCAGTCCCCAA 0: 1
1: 0
2: 0
3: 5
4: 135
Right 1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG 0: 1
1: 0
2: 0
3: 23
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167751082 Original CRISPR GCGGCGGCCCAGGAAGCTGA CGG Exonic
900162052 1:1228481-1228503 GCGGAGCCGGAGGAAGCTGATGG - Exonic
900310821 1:2032435-2032457 AGGGAGGCCCAGGAAGCAGAGGG - Intergenic
900463954 1:2814896-2814918 GATGCGGCCCAGGAAGATGCAGG - Intergenic
902552672 1:17228814-17228836 GGGGTGGCCAAGGAGGCTGAGGG + Intronic
902719773 1:18296186-18296208 AAGGGGTCCCAGGAAGCTGATGG - Intronic
902857948 1:19222727-19222749 GGGGCGGTCCAGGGAGCTGAAGG + Exonic
903170290 1:21548218-21548240 GTGGCAGCCCTGGAAGCGGAGGG - Intronic
904619573 1:31767090-31767112 ACAGAGGCCCAGAAAGCTGAAGG - Intergenic
904659934 1:32076800-32076822 GCGGCGGCCCAGAACGATGGTGG - Exonic
906190945 1:43899161-43899183 GCGGCGGCAGCGGAGGCTGAGGG - Exonic
906236327 1:44213538-44213560 GCGAGGGCCCAGGTGGCTGAAGG + Exonic
908014231 1:59814887-59814909 GCCGGGGCCCAGGAAGGGGAGGG + Exonic
911612291 1:99970216-99970238 GGGGCGGCCCGGGAAGCTCCTGG + Intronic
912421050 1:109542844-109542866 GCGCCAGGCCAGGCAGCTGAAGG - Exonic
912915635 1:113812037-113812059 GCAGCGGCCCAGGATGTTGGCGG + Exonic
913578014 1:120196956-120196978 GAGGAGGCCCAGGGAACTGACGG + Intergenic
913630158 1:120701396-120701418 GAGGAGGCCCAGGGAACTGACGG - Intergenic
914195907 1:145448073-145448095 GTGGTTGCCCAGGAAGCTCAGGG + Intergenic
914480330 1:148060397-148060419 GCGGCGGCTCGGGTCGCTGACGG - Intergenic
914559930 1:148808376-148808398 GAGGAGGCCCAGGGAACTGACGG + Intronic
914612903 1:149321839-149321861 GAGGAGGCCCAGGGAACTGACGG - Intergenic
915329879 1:155104372-155104394 CCAGCCGCTCAGGAAGCTGAGGG - Intergenic
915836912 1:159184289-159184311 GCTGCGGCCCAGAATACTGAAGG - Intronic
917673875 1:177300968-177300990 GCAGCAGTCCAGGAAGCTAAGGG + Intergenic
918064341 1:181089350-181089372 GCGGCGGCCAGAGAAGCCGAGGG + Exonic
920046099 1:203133559-203133581 GCGTCAGCCCAAGAAGCTGTAGG + Intronic
920102408 1:203525641-203525663 CAGGAGGCCCAGGAAGCTGCTGG + Intergenic
921155150 1:212433199-212433221 CCGGCGGCCCAGGAAGCTCTGGG + Intronic
921308385 1:213819453-213819475 GATGGGGCCCAGGAATCTGAAGG + Intergenic
924230389 1:241957774-241957796 GCGCTGGCACAGGAAGCGGATGG - Intergenic
1062911557 10:1215457-1215479 GGGGAGGGCCAGGAAGCCGAAGG - Intronic
1063949334 10:11207712-11207734 GCCACTGCCTAGGAAGCTGACGG - Intronic
1066987015 10:42476376-42476398 GCGGCAGCCCGGGAAGAGGATGG + Intergenic
1067145763 10:43692614-43692636 GCTTGGGGCCAGGAAGCTGAAGG - Intergenic
1067498027 10:46776147-46776169 CCGGCTCCCCAGGAAGGTGATGG - Intergenic
1067596619 10:47564267-47564289 CCGGCTCCCCAGGAAGGTGATGG + Intergenic
1069571012 10:69494495-69494517 GCGGAGGCCCAGGTGGCTGTAGG + Intronic
1069962334 10:72086569-72086591 GCTGCTGCCCAGGAAGCGGCAGG + Intronic
1070149633 10:73797774-73797796 GCGGCGGCCCTTGTACCTGAAGG - Exonic
1071759309 10:88582947-88582969 ACGGCCGCTCAGGGAGCTGAGGG + Intronic
1072102265 10:92240080-92240102 GCGGCTGCTGAGGAGGCTGATGG + Exonic
1075687059 10:124371548-124371570 GAGGCAGCCCAGGAAGCACAGGG + Intergenic
1075797902 10:125134437-125134459 GCAGAGGGCCAGGAAGCAGAGGG - Intronic
1077225127 11:1436252-1436274 GTGGCGGCCCAGGAGCCTGCAGG - Intronic
1079056114 11:17207920-17207942 GCGGCGGCTGAGCCAGCTGAGGG - Intronic
1079136733 11:17779715-17779737 GCGGCGGGCAAGGGCGCTGAGGG + Intronic
1080791488 11:35525846-35525868 GCGGCTGCAAAGGAAGCTGCGGG + Intronic
1081610193 11:44557570-44557592 CCTGTGGCCCAAGAAGCTGATGG - Intergenic
1083332559 11:61905728-61905750 CCAGGGACCCAGGAAGCTGAAGG + Intronic
1083554378 11:63614227-63614249 GCGGGCGCCCAGGAGGCTGCAGG + Exonic
1083625497 11:64069982-64070004 GCAGGGGGCCAGGAAGCTGGGGG + Intronic
1083722352 11:64609623-64609645 GAGGAGGACCAGGAGGCTGATGG - Intronic
1083883826 11:65561084-65561106 GCGGAGGCCCTGAGAGCTGAAGG - Intergenic
1084695963 11:70755783-70755805 GCGGCGTTCCAGGAATCTGCTGG - Intronic
1084707706 11:70824967-70824989 GGGGTGCCCCAGGAAGCTGGGGG - Intronic
1085119433 11:73957696-73957718 GGGGCGGCACAGGAACCGGACGG + Intronic
1085409740 11:76284041-76284063 GCTGCGGCCCGGCAAGCTCATGG + Intergenic
1085626906 11:78080643-78080665 TCGGCTGCTCGGGAAGCTGAGGG + Intergenic
1088383367 11:109221356-109221378 GCTGAGGCCCAGGGAGATGAGGG + Intergenic
1088504741 11:110516779-110516801 GTGGTGGCCAAGGAAGCTGGAGG - Intergenic
1088553182 11:111035486-111035508 GCAGAAGGCCAGGAAGCTGAGGG + Intergenic
1089274834 11:117327877-117327899 CCGGCGTCCCTGGAAGCTGGGGG + Exonic
1090636375 11:128692880-128692902 GCGGCGGCCCAGGAGGGAGGCGG + Intronic
1091555936 12:1573554-1573576 CCGGAGGCTCAGGCAGCTGAGGG + Intronic
1091882456 12:3990722-3990744 GCGGGGGCCCAGGCTGCTGTGGG + Intergenic
1091934309 12:4423201-4423223 GCGGCGGCTGTGGAGGCTGAGGG - Intergenic
1094199157 12:27779914-27779936 GGGGAGGCCCGGGAAGCTGCGGG - Intergenic
1096239090 12:49950056-49950078 GGGGCGGCTGAGGAAGCTGAGGG - Intergenic
1096747744 12:53739413-53739435 GCAGGGTCCCAGGAAGGTGAGGG + Intergenic
1097002721 12:55891415-55891437 TCGGCTGCTCAGGAGGCTGAGGG + Intergenic
1103204815 12:119120385-119120407 ACTGAGGCCCAGGAAGATGAAGG - Intronic
1104012386 12:124940862-124940884 GCCACCGCCCAGGAAGCTGCTGG + Intergenic
1104444422 12:128822407-128822429 GCCCTGGGCCAGGAAGCTGAGGG - Intronic
1104663710 12:130632517-130632539 CCGGCAGCCCAGGAAGATGAGGG - Intronic
1104932717 12:132348239-132348261 GGGACGGCCCAGAGAGCTGAAGG - Intergenic
1105930353 13:25046878-25046900 GCGGCGGCCCCGGCAGCTGCAGG - Intergenic
1107624846 13:42272061-42272083 GCGGCGGCGGCGGAAGCCGAGGG + Intergenic
1108668024 13:52652260-52652282 GCGTCGCCCCAGGAACCAGAAGG + Intergenic
1110318528 13:74135366-74135388 GCGGAGCCCCAAGAAGCGGACGG + Intergenic
1110969231 13:81739960-81739982 GCAGGAGCCCAGGAAGCTGGAGG - Intergenic
1111640870 13:90968274-90968296 GCTGTGGCCCAGGAAGAAGAGGG - Intergenic
1112402027 13:99086165-99086187 GCGGGGGCGCAGGCAGCTGCGGG - Intronic
1113340617 13:109421410-109421432 GAGGCGGGCCAGGGGGCTGAGGG - Intergenic
1113481976 13:110627919-110627941 ACAACGGCCCAGGAGGCTGAGGG - Intronic
1113885473 13:113656495-113656517 GCGGGGGCCCAGGAAGTGCAGGG - Intronic
1114483261 14:23048088-23048110 GCCGGAGCCCAGGGAGCTGAGGG + Exonic
1118366438 14:65101653-65101675 CCGGCGGCAGAGGAAGCGGAGGG + Intronic
1118719087 14:68580928-68580950 GCTGGGGCTCAGGAGGCTGAGGG + Intronic
1118751539 14:68811313-68811335 GAGGAGGCCCAGGCAGCTGGCGG + Intergenic
1118849568 14:69573492-69573514 GCCGAGGCCGAGGAAGCTGCGGG + Exonic
1119500887 14:75126739-75126761 GCCGCGGCCCAGGACGCGGATGG + Exonic
1122301151 14:100731862-100731884 GCTGAGGCTCAGGAAGCTGAAGG - Intronic
1122613564 14:103001693-103001715 GGAGCGGCCCCGGCAGCTGACGG + Intronic
1125001114 15:34770785-34770807 GAGGCAGACCAGGGAGCTGATGG - Intergenic
1127296707 15:57614994-57615016 GAGGCAGCCCAAGGAGCTGATGG - Intronic
1127935739 15:63635987-63636009 GCGGCGGCCCAGGCAGATCGAGG - Exonic
1132572915 16:651786-651808 GTGATGGCCCAGGACGCTGATGG + Intronic
1132592010 16:730183-730205 GGGGTGGCCCAGGCAGCAGAAGG - Exonic
1132678485 16:1130370-1130392 GAGGCTGCCCAGGAGGCTGGGGG + Intergenic
1133782925 16:8953550-8953572 GCGGCGCCACCGGAAGCAGAGGG + Intronic
1133782934 16:8953589-8953611 GCGGCGCCACCGGAAGCAGAGGG + Intronic
1133782943 16:8953628-8953650 GCGGCGCCACCGGAAGCAGAGGG + Intronic
1133870533 16:9681695-9681717 GCAGCAGCCCATGAAGCTCAGGG - Intergenic
1136087791 16:27897933-27897955 ACGGCAGCCTATGAAGCTGATGG + Intronic
1136493218 16:30624562-30624584 GGGGCTGCCCAGGAAGAGGAGGG + Intergenic
1138533286 16:57646512-57646534 GCGGCTGCTCTGGAAGCTGGGGG + Intronic
1141384471 16:83606803-83606825 GCGGCGGAGCAGAAAGCTAAGGG - Intronic
1141663816 16:85455537-85455559 GCGGCTACCCAGGAAACAGAAGG + Intergenic
1141869930 16:86778464-86778486 GAGGCGGCCGGGGCAGCTGAGGG - Intergenic
1142138480 16:88462142-88462164 ACGGAGGCACAGGAGGCTGAGGG - Intronic
1142395373 16:89828675-89828697 GCGGCAGCCCTGGAAGCACACGG - Exonic
1143002839 17:3805847-3805869 GCTGAGGCCCAGGGAGGTGAGGG + Intergenic
1143102625 17:4512835-4512857 GCGGGGGCCCTGAAAGCTGCGGG - Intronic
1143103796 17:4518597-4518619 GGGGCAGCAGAGGAAGCTGAAGG + Intronic
1144269389 17:13601903-13601925 GCGGCGGCCCAGGAGGCAGCCGG - Exonic
1144942898 17:18953505-18953527 ACTGAGGCCCAGGAAGCTGAGGG - Intronic
1146213224 17:30958022-30958044 GGGAAGGCCCAGGGAGCTGATGG - Exonic
1146814338 17:35930529-35930551 GCGGAGGCTCAGGCAGGTGAGGG + Intronic
1147401279 17:40181392-40181414 GCAGCTGCCAAGGCAGCTGAAGG - Intronic
1147965138 17:44190652-44190674 GAGGGGGCCAAGGAGGCTGAGGG - Exonic
1148106375 17:45121015-45121037 GCGGCGGCCCTTGAAGGCGATGG + Exonic
1148336037 17:46841947-46841969 GCGGCGGCCGCGGACGCTGGAGG - Intronic
1148780243 17:50117432-50117454 GTGGCGGCGCACGAAGCTGGGGG + Exonic
1148865552 17:50626429-50626451 GCCGCTGTCCAGGCAGCTGACGG - Exonic
1149296753 17:55267956-55267978 GCTGCAGCCCAGGAGGGTGAGGG - Exonic
1151750212 17:76032847-76032869 GCTGTGGCCCAGGAATCTGCAGG + Intergenic
1151759434 17:76092194-76092216 GCAGCTCCCCAGAAAGCTGAGGG + Intronic
1151842745 17:76629317-76629339 GGGCCAGACCAGGAAGCTGACGG - Exonic
1152228955 17:79105246-79105268 GCAGGGACCCAGGGAGCTGATGG + Intronic
1152405636 17:80096494-80096516 GGGCCGGGCTAGGAAGCTGAGGG - Intronic
1152546787 17:81004218-81004240 GCGGCGGCGCGGGAAGCAGGCGG + Intronic
1152644098 17:81460914-81460936 ACGGCGGCCCAGGAAGTGGTCGG - Exonic
1152758078 17:82095434-82095456 CCGGCGGTCCGGCAAGCTGAAGG - Exonic
1153521921 18:5961930-5961952 GCTGGGGCCCAGGACACTGAGGG + Intronic
1153923383 18:9811165-9811187 GCGGTGGCCGAAGATGCTGAAGG - Intronic
1156395051 18:36691737-36691759 CCTGCAGCCCAGGATGCTGAGGG - Intronic
1157116135 18:44864332-44864354 GCCGCTGCTTAGGAAGCTGAAGG + Intronic
1157453127 18:47802689-47802711 GCGAGGGCCCAGGAAACTGAGGG - Intergenic
1158465463 18:57686145-57686167 CCAGCTACCCAGGAAGCTGAGGG + Intronic
1160403896 18:78631323-78631345 GCAGCAGCCCAGGCACCTGATGG + Intergenic
1160718441 19:586976-586998 GGTGCGGCCCGGGAAGCTGCAGG - Intergenic
1160740069 19:681507-681529 GGAGCGGCCCAGGAAGCAGGTGG - Exonic
1161162003 19:2767030-2767052 CCTGGGGCCCAGGGAGCTGAGGG - Intronic
1161195201 19:2982792-2982814 GCAGGGGCCCAGGGAGCGGAAGG - Intronic
1161571937 19:5035564-5035586 GCGGCAGCCAAGGAGGCAGAGGG - Intronic
1162481422 19:10929007-10929029 GCGCGGGCCCAGGACCCTGAGGG - Exonic
1164650763 19:29889927-29889949 GAGGCTGCAGAGGAAGCTGAAGG + Intergenic
1164746828 19:30622670-30622692 GCGGGGAACCAGGGAGCTGAGGG - Intronic
1165069951 19:33249340-33249362 GCGGGTGCCCAGGAGGCTGCGGG + Intergenic
1165145637 19:33728358-33728380 GCTGCTACCCAGGAAGCAGAGGG - Intronic
1165343345 19:35227713-35227735 GGGGAAGCCCAGGAAGCTTAGGG - Intronic
1165381949 19:35488021-35488043 GCGGAGGCCGAGGGAGCTGAAGG + Intronic
1165867861 19:38949936-38949958 GGCGGGGCCCAGGAGGCTGAGGG - Intronic
1166331540 19:42080662-42080684 GAGGCGGCCCATGCAGCTGCTGG + Exonic
1166361080 19:42253348-42253370 GCGGCAGGCCAGGAGGCAGACGG + Intronic
1166714061 19:44955399-44955421 GCGGCGGCGCAGGAGGCGGACGG + Exonic
1167063542 19:47167064-47167086 CCAGCTGCTCAGGAAGCTGAGGG - Intronic
1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG + Exonic
1168110066 19:54187209-54187231 GGGCAGGCCCAGGAGGCTGAGGG + Exonic
924985139 2:264015-264037 GAGGCTGCCCAGGAAGAGGAAGG + Exonic
925346601 2:3176216-3176238 GCGGCGGCCCAGGGCTCTGTCGG + Intergenic
927591364 2:24360564-24360586 GCGCCGGGCCGGGCAGCTGACGG + Exonic
927698523 2:25252798-25252820 TAGGAGGCCCAGGAAGCTGTAGG + Intronic
927809375 2:26173125-26173147 GCGGCGGCCCCGGGAGGTGGCGG + Exonic
929875512 2:45793282-45793304 GCAGCAGCCCAGGAAACAGATGG - Intronic
932567050 2:72917039-72917061 ACCGCGGCCCAGGAGGCCGATGG + Intronic
932696674 2:73962723-73962745 ATGGCAGCCCAGGAAGCAGAAGG - Intergenic
932773710 2:74515064-74515086 GCGGCGGCACAGGCAGCGGGCGG - Exonic
934864349 2:97792605-97792627 GCGGTGGCAGAGGAGGCTGAGGG + Exonic
935304145 2:101720286-101720308 CTGGCGACTCAGGAAGCTGAGGG - Intronic
936094899 2:109523997-109524019 GAGGTGGCCCAGGACTCTGAAGG - Intergenic
937932970 2:127219931-127219953 GCTGCTGCCCAGAAGGCTGACGG - Intronic
938115789 2:128602260-128602282 GCTGAGGCCCAGGGAGCCGAGGG + Intergenic
938953997 2:136281992-136282014 GCTGCTGCCCAGGGGGCTGAGGG + Intergenic
939141747 2:138362286-138362308 GCTGAGGCCCAGATAGCTGAAGG + Intergenic
941046673 2:160683774-160683796 CCGAAGGCCCAGGAAGGTGAGGG + Intergenic
946179142 2:217939653-217939675 GCGGGGGCCTGGGGAGCTGATGG - Intronic
946427927 2:219609229-219609251 GTGGGGGCCCAGGAGGCTGTGGG + Intronic
948586089 2:239020693-239020715 GCGGAGCCCCAGGGACCTGATGG + Intergenic
948809267 2:240466571-240466593 GCGGCGGTGCAGGGAGCTGGGGG - Exonic
948831954 2:240602620-240602642 GCGGTGCCACAGGAAGCTGGTGG - Intronic
1169433049 20:5556699-5556721 GTGGCTGCCAAAGAAGCTGATGG + Intronic
1171424998 20:25043546-25043568 TCAGAGTCCCAGGAAGCTGAGGG - Intronic
1176386511 21:6140791-6140813 GCGTGGCCCGAGGAAGCTGAGGG + Intergenic
1179436273 21:41364188-41364210 GTGAAGGCCCAGGAAGCTGGTGG - Intronic
1179548054 21:42125344-42125366 GAGGGTGGCCAGGAAGCTGAGGG + Intronic
1179736962 21:43397461-43397483 GCGTGGCCCGAGGAAGCTGAGGG - Intergenic
1179845189 21:44107234-44107256 GCAGCGGCCCAGGAGGCAGGAGG - Intergenic
1180053902 21:45347246-45347268 GCAGCGGCACAGGGAGCTGCTGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1185319099 22:50192337-50192359 CCGGGGGCCCAGGAGCCTGAGGG - Intronic
950613097 3:14138660-14138682 GTGGAGGCCAAGGAAGCAGATGG + Intronic
950634243 3:14303795-14303817 GCTGTGGACTAGGAAGCTGAGGG - Intergenic
951803722 3:26623906-26623928 GCGGTGGAGGAGGAAGCTGAGGG + Intronic
952839338 3:37630938-37630960 GAGGCAGGGCAGGAAGCTGATGG + Intronic
952889261 3:38029849-38029871 GCGGCGGCGGAGGAAGCTGGAGG - Intergenic
954238736 3:49277071-49277093 GGGGCGGGCCAGGAAGCTGTGGG - Exonic
958013697 3:87914075-87914097 GAGATGGTCCAGGAAGCTGAAGG + Intergenic
961657929 3:128453564-128453586 GCAGCGACCCAGGAACCTGAAGG + Intergenic
963228773 3:142889057-142889079 GGGGCGGCCCAGGTAGCCGGGGG + Exonic
966851053 3:184165167-184165189 GCGGCGGCGGCGGAAGCAGAAGG + Exonic
968221438 3:196942889-196942911 GCGGCGGCACAGGGAGCCCACGG - Intergenic
969304789 4:6319416-6319438 GCGGAGGCCCAGGGTGGTGATGG - Intergenic
969607591 4:8210252-8210274 AAGGGGGCCCAGGAAGCTGCTGG + Intronic
969619480 4:8271920-8271942 GAGACTGCCCAGGAGGCTGAGGG + Intronic
969707269 4:8818823-8818845 GCTGCGGCCCAGAAAGCTTTGGG + Intergenic
969854362 4:9987232-9987254 CCAGCTACCCAGGAAGCTGAGGG - Intronic
973623690 4:52751182-52751204 TCGGCGGCCCAGGGGGCGGACGG - Intronic
980027316 4:127782160-127782182 ACGGCTGCCCAAGAAGCTGCGGG - Exonic
983940413 4:173530128-173530150 GCGGTGGCCGAGGAAGCTCCGGG + Exonic
985401378 4:189597642-189597664 GCGACGTCCCAGGAAAGTGAAGG + Intergenic
985967400 5:3348119-3348141 GAGGGGGCACAGGAAGCTGGAGG - Intergenic
986233282 5:5885882-5885904 GTGGTGGCCCAGAAGGCTGATGG - Intergenic
989103104 5:37838611-37838633 GCTGGGCCCCAGGAAGCTGGCGG + Intronic
989384288 5:40838924-40838946 CCAGCTGCTCAGGAAGCTGAGGG + Intergenic
991674253 5:69075766-69075788 GAGGCTGCACAGGAAGCCGAGGG - Intergenic
992233709 5:74686582-74686604 GCAGAGGCCCAAGATGCTGATGG + Intronic
996948103 5:129094499-129094521 GCAGCGGCCCGGGAAGCTGGAGG + Intergenic
997963236 5:138338278-138338300 GCCGCGGCCCTGGGAGCTGGAGG + Exonic
998040177 5:138946559-138946581 GTGGTGACCCAGGCAGCTGATGG - Intergenic
998411000 5:141911081-141911103 CCAGCTGCTCAGGAAGCTGAGGG + Intergenic
998467362 5:142356806-142356828 GCGGCGGCGCACCAATCTGAAGG - Intergenic
998849910 5:146342681-146342703 GCTGAGGCCCAGGGAGCTGGGGG - Intergenic
999374719 5:151078975-151078997 TCGGGGCCCCAGGAAGCTGTGGG - Intronic
999379273 5:151108901-151108923 GAGGAGGCCCAGGAAGGAGAGGG - Intronic
1001242108 5:170078893-170078915 GCAAGGACCCAGGAAGCTGAAGG - Intronic
1002211119 5:177600042-177600064 GCGGCGGCTCCGGGAGCTGGCGG + Intergenic
1002311587 5:178318416-178318438 CCTTCGGCCCAGGCAGCTGAAGG + Intronic
1002523699 5:179804692-179804714 GCGGGGGTCCAGGAACTTGAGGG - Intronic
1005303813 6:24495178-24495200 GCGGCCGCCCACGAAGCTGTCGG - Exonic
1006831568 6:36971194-36971216 GCCGCTCCACAGGAAGCTGAGGG - Intronic
1006839811 6:37021563-37021585 GCTGCGGCCCAGGGGCCTGAGGG + Exonic
1007595095 6:43046324-43046346 GCACCGGGCCAGCAAGCTGACGG - Exonic
1008200933 6:48589273-48589295 GTGGAGGCCCAGGAAGCAGTGGG + Intergenic
1008457374 6:51726568-51726590 GGGCTGGCCCAGGAAGCTGGAGG - Intronic
1009025389 6:57993070-57993092 CCAGCTGCCCAGGAGGCTGAGGG + Intergenic
1010214575 6:73390062-73390084 CCAGCAGCTCAGGAAGCTGAGGG + Intronic
1012247197 6:96938919-96938941 GCAGGGGCCCAGGAAGCTAATGG + Intronic
1012429519 6:99149789-99149811 TTGGCGGCCAAGGAAGCGGATGG + Intergenic
1015549692 6:134399471-134399493 GCCTGGGCCCAGGAAGTTGAGGG + Intergenic
1016461174 6:144281549-144281571 GGTGGGGCCCAGGAAGCTGCAGG - Intergenic
1016918287 6:149265538-149265560 GTGGGGGCCAAGGAAGCTTAAGG - Intronic
1016923499 6:149317973-149317995 GCGGCGGCCGAGGAGGAGGAGGG + Intronic
1019138459 6:169927466-169927488 TGGGTGGCCCAGGAAGCTGGTGG + Intergenic
1019197768 6:170291861-170291883 GCGGCGGCCGAGGATCCTGTGGG - Intergenic
1019778251 7:2925118-2925140 CCTGCGGGCCGGGAAGCTGATGG - Intronic
1019828208 7:3301201-3301223 GCGGCGGCCGCGGCAGCTGAGGG + Intergenic
1019951320 7:4375392-4375414 GCAGAGGCACAGGAAGCTGCAGG + Intergenic
1022211407 7:28213703-28213725 GTGGTGGCCCAGCAGGCTGAAGG - Intergenic
1022373764 7:29794069-29794091 GAAGGGACCCAGGAAGCTGAAGG - Intergenic
1022527672 7:31049014-31049036 ATGGCTGCCCAGGAGGCTGAGGG + Intergenic
1024048669 7:45602343-45602365 GCAGCGGAGGAGGAAGCTGAGGG - Intronic
1025608191 7:63054385-63054407 GCGGCGGACAAAGATGCTGAAGG - Intergenic
1029367674 7:100127157-100127179 GCGGGGGCCGAGGACGCCGAGGG + Intronic
1029973139 7:104809008-104809030 CCAGCTACCCAGGAAGCTGAGGG - Intronic
1032496761 7:132368583-132368605 GCCGCAGCGCAGGCAGCTGAGGG - Intronic
1033172214 7:139094171-139094193 GTGGGGGCCCAGGAATCTAATGG - Intronic
1034129023 7:148698907-148698929 GGGGCAGCCCCGGTAGCTGAGGG + Exonic
1034902185 7:154914576-154914598 GCTGCAGCCCTGGAAGCTGCTGG - Intergenic
1035224779 7:157427073-157427095 GCGGGGGCCCAGGGACCTCACGG - Intergenic
1035273795 7:157735465-157735487 GCAGCGGCCCAGGAAGGTGGAGG + Intronic
1035548141 8:499494-499516 GCAGGGGCTCAGGAAGCTGGTGG - Intronic
1036645122 8:10607892-10607914 GAGGAGGCACAGGAGGCTGAAGG - Exonic
1036645201 8:10608243-10608265 GAGGCGGCCCAGGAGGCAGAAGG - Exonic
1036645258 8:10608504-10608526 GGGGATGCCCAGGAGGCTGAAGG - Exonic
1037273719 8:17156476-17156498 GCGGAGGCCGAGGAGGCGGAGGG - Exonic
1037765180 8:21768407-21768429 GCGGGGGCACAGGGGGCTGAGGG - Intronic
1039476571 8:37842018-37842040 GCTGCTGCCCAGGTAGCTGTCGG - Exonic
1040337534 8:46423657-46423679 GGGGCGGCCCTGGAAGTTTATGG - Intergenic
1041801679 8:61807278-61807300 CCAGCTGCTCAGGAAGCTGAGGG - Intergenic
1042859147 8:73295420-73295442 GAGGCGGCCCAGGCCGCTGCCGG - Exonic
1043568273 8:81571467-81571489 GCGGCAGCAGAGGAGGCTGAGGG - Intergenic
1048866903 8:138768089-138768111 GCGGAGGGCCAGGAGGCTGTGGG - Intronic
1049973341 9:840348-840370 GAGGCGGCCCAGGATCCTGAAGG + Intergenic
1053316781 9:37058813-37058835 GAGGCAGACCAGGGAGCTGAAGG - Intergenic
1056180614 9:84078816-84078838 GAGCAGGCCCAGAAAGCTGAAGG + Intergenic
1057312877 9:93952681-93952703 GGCATGGCCCAGGAAGCTGAGGG + Intronic
1057898685 9:98930622-98930644 GATGCTGCCCAGGAGGCTGAGGG - Intergenic
1060233346 9:121841681-121841703 ACAGCAGCCCAGGAAGCTGAAGG + Intronic
1060943857 9:127558436-127558458 ACTGAGGCCCAGGAAGATGATGG - Intronic
1061074848 9:128334830-128334852 GCTTGGGCCCAGGAAGTTGAGGG - Intergenic
1061108519 9:128551081-128551103 GCAGAGGGCCAGGAAGCTCAGGG + Intergenic
1061299858 9:129698157-129698179 GAGGGGGCCCAGAGAGCTGAAGG - Intronic
1061671782 9:132192913-132192935 GCCCCGGCCCGGGAAGCAGATGG - Intronic
1062356908 9:136169395-136169417 GCTGTAGCCCAGTAAGCTGATGG - Intergenic
1062364787 9:136203400-136203422 GCTCCGGCGCAGGAAGCTGCGGG - Intronic
1062698825 9:137888749-137888771 GTGGTTGCCCAGGAAGCTCAGGG - Intronic
1189301353 X:39954807-39954829 GCTCCAGCGCAGGAAGCTGAGGG - Intergenic
1189491486 X:41474424-41474446 GAGGCGGCCCAGGAAGAAGCCGG - Exonic
1189726265 X:43970381-43970403 GCCGCTGGCCAAGAAGCTGAGGG + Intronic
1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG + Intronic
1198214581 X:134545027-134545049 GCGGCGCCCCGGGAGCCTGAGGG + Intergenic
1198839740 X:140843633-140843655 GAGGCCACCCCGGAAGCTGAGGG + Intergenic
1199746635 X:150775925-150775947 GCTGGGGCCCTGGAAGGTGAAGG + Intronic
1199966477 X:152824726-152824748 GGGCTGGCCCAGGAAGCTGGAGG - Intergenic
1200096713 X:153667985-153668007 GAGGCTGCCCAGGGTGCTGAAGG + Intergenic
1200794992 Y:7332857-7332879 GCTGAAGCCCAGGACGCTGAGGG - Intergenic