ID: 1167752478

View in Genome Browser
Species Human (GRCh38)
Location 19:51389148-51389170
Sequence CTGGCTGCTCAGCTCTCCCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 366}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167752472_1167752478 -8 Left 1167752472 19:51389133-51389155 CCGCCCGGCCCCTCTCTGGCTGC 0: 1
1: 0
2: 7
3: 67
4: 589
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752466_1167752478 2 Left 1167752466 19:51389123-51389145 CCAGGGCCCCCCGCCCGGCCCCT 0: 1
1: 1
2: 10
3: 156
4: 1242
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752467_1167752478 -4 Left 1167752467 19:51389129-51389151 CCCCCCGCCCGGCCCCTCTCTGG 0: 1
1: 0
2: 5
3: 74
4: 678
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752471_1167752478 -7 Left 1167752471 19:51389132-51389154 CCCGCCCGGCCCCTCTCTGGCTG 0: 1
1: 1
2: 11
3: 71
4: 668
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752464_1167752478 4 Left 1167752464 19:51389121-51389143 CCCCAGGGCCCCCCGCCCGGCCC 0: 1
1: 0
2: 11
3: 148
4: 978
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752470_1167752478 -6 Left 1167752470 19:51389131-51389153 CCCCGCCCGGCCCCTCTCTGGCT 0: 1
1: 2
2: 20
3: 179
4: 1172
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752469_1167752478 -5 Left 1167752469 19:51389130-51389152 CCCCCGCCCGGCCCCTCTCTGGC 0: 1
1: 0
2: 8
3: 58
4: 554
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752461_1167752478 15 Left 1167752461 19:51389110-51389132 CCTGGGGCCAGCCCCAGGGCCCC 0: 1
1: 1
2: 19
3: 129
4: 947
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752465_1167752478 3 Left 1167752465 19:51389122-51389144 CCCAGGGCCCCCCGCCCGGCCCC 0: 1
1: 0
2: 5
3: 118
4: 1026
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366
1167752462_1167752478 8 Left 1167752462 19:51389117-51389139 CCAGCCCCAGGGCCCCCCGCCCG 0: 1
1: 0
2: 8
3: 114
4: 1126
Right 1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG 0: 1
1: 0
2: 1
3: 44
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167752478 Original CRISPR CTGGCTGCTCAGCTCTCCCA AGG Exonic
900313905 1:2047826-2047848 CTGGCAGCACAGATCTCCCCAGG + Intergenic
900410924 1:2512289-2512311 CTGGGTTCTCAGCCCTCCCTGGG - Intronic
900514027 1:3072897-3072919 CTGGCTGCGCAGGTGTGCCATGG + Intronic
900570755 1:3357160-3357182 CTGGCTGCTGAGGCTTCCCAGGG - Intronic
901109436 1:6784269-6784291 GTGGCTGGGCAGCGCTCCCAGGG - Intergenic
901208395 1:7510413-7510435 CTGGGGGCTCACCTGTCCCATGG + Intronic
901462074 1:9397939-9397961 TTGGCTTCTGAGCTCTCTCACGG - Intergenic
901479805 1:9517289-9517311 CTGACAACTCAGCTCTGCCATGG + Intergenic
902878122 1:19353138-19353160 ATGGGTCCTCAGCTTTCCCAGGG - Intronic
902929885 1:19723532-19723554 CTGCATGCTCAGCTCTCTCAGGG + Intronic
902935823 1:19763888-19763910 CTGGCTGCAGAGCCCTCACAGGG + Intronic
902942972 1:19813829-19813851 CTGGTTGTTTAGGTCTCCCATGG - Intergenic
903023446 1:20410572-20410594 CTGGCTGCCCAATTCTCCCTTGG - Intergenic
903030721 1:20462422-20462444 CTGGGGTCTCAGCTCTTCCAAGG + Intergenic
903742756 1:25567746-25567768 CTGGCTGCTCCCTGCTCCCAGGG + Exonic
904277121 1:29391916-29391938 GGGGCTGCTCAGCTCTGCCCAGG - Intergenic
905042435 1:34971173-34971195 CTGGCTGTGCAGATATCCCATGG - Intergenic
905693756 1:39960477-39960499 CAGGCTGCTCAGGGCTCCCCCGG + Intronic
906514474 1:46430946-46430968 CTGGCTGCCGAGGTCACCCATGG + Intergenic
906517481 1:46448218-46448240 CTGCCTGCCCAGCGCTCCCGAGG - Intergenic
906692098 1:47799283-47799305 CTGGCTGCTCAGGACTCACGGGG + Intronic
906696290 1:47825572-47825594 TTGGATGCTGAGCTCTGCCAGGG + Intronic
907043535 1:51284698-51284720 CTGGGCCCTCAGCTCTCCCATGG - Intergenic
907240371 1:53077716-53077738 CAGGCTGCTCAGCTCGCTGAAGG - Exonic
907513814 1:54980850-54980872 CTGGCTCCTGGGCCCTCCCAGGG - Exonic
912707824 1:111927966-111927988 GTCACTGCTCACCTCTCCCAGGG + Intronic
915946160 1:160153181-160153203 CTTGGTGCTCAGCTCTTCCAAGG - Exonic
916428469 1:164704329-164704351 CTGGTTGCACAGCTTTCCCAGGG + Intronic
921222141 1:212980899-212980921 CTGCCTGGTCAGTTCCCCCAGGG + Intronic
921953782 1:220960705-220960727 CTACATGCTCAGCTCTGCCAAGG - Intergenic
922206966 1:223456413-223456435 AGGTCTGCTGAGCTCTCCCAAGG - Intergenic
922819356 1:228473459-228473481 TTGGATGCACAGCTCTCCCTTGG - Intergenic
922975127 1:229777962-229777984 CTTGCTACTCTGGTCTCCCATGG - Intergenic
1063524372 10:6771042-6771064 CCGACTGCTCAGCTATGCCAAGG + Intergenic
1064327467 10:14364424-14364446 CTAGCTGATCAGCTGTCCCGGGG + Intronic
1064327634 10:14365584-14365606 CTAGCTGATCAGCTGTCCCAGGG + Intronic
1065032310 10:21599809-21599831 CTGCCTGCTCTGGCCTCCCAAGG + Intronic
1067993571 10:51243360-51243382 CTGGCTTCACAGCTATTCCAGGG - Intronic
1068314146 10:55319987-55320009 CTGTCTGCTGGCCTCTCCCAGGG + Intronic
1068578312 10:58709465-58709487 CTAGGTGGTCAGCTCTCCAAAGG + Intronic
1070787911 10:79172825-79172847 CTGGTTGTTCATCTTTCCCATGG - Intronic
1070798357 10:79230284-79230306 CCTGCTGCTCGGCTCTGCCAGGG + Intronic
1071161166 10:82746496-82746518 CTGAATGCCCAGCTCTCCCAGGG - Intronic
1071968398 10:90876904-90876926 CTGGCTGCTCAGGCCACCTAGGG - Intronic
1072026758 10:91467472-91467494 CTGACTGCTGGCCTCTCCCAGGG + Intronic
1072694258 10:97591153-97591175 CTGGCTGCTCCCCTCTTCCCTGG - Intronic
1075397607 10:122139238-122139260 CTGGCTGGTCAGCTCTTCCCTGG - Intronic
1075651040 10:124128489-124128511 CTGGCTGGTCAGCCCACCCCAGG + Intergenic
1075717669 10:124566342-124566364 CTCCCTGCCCAGCGCTCCCAGGG - Intronic
1076545654 10:131244408-131244430 CTGCATGCTCCACTCTCCCAGGG - Intronic
1076559073 10:131349378-131349400 CTGGCAGGTCAGCACTCCCAGGG - Intergenic
1076688700 10:132209700-132209722 CTGGCCGCTCAGCGCTGGCATGG + Intronic
1077008098 11:368726-368748 CTGTCTGCTCAGCTGTCTCTGGG - Intergenic
1077296013 11:1826619-1826641 CTGCCCGCTCATCTCTCCCACGG + Intergenic
1078430033 11:11281476-11281498 CTGGCTGCTCAGCTCATCCTTGG + Intronic
1078897222 11:15607372-15607394 CTGGCTCCTCAGATACCCCAGGG - Intergenic
1079865543 11:25729246-25729268 CTGTCTGCTGGTCTCTCCCAGGG - Intergenic
1080022264 11:27574869-27574891 GTGTCTGCTCAGGTCTCACAAGG - Intergenic
1080407960 11:31996791-31996813 CTGGCTCCTCAGCTTTCAGATGG - Intronic
1081152348 11:39648036-39648058 GTGGCTGCTCAGCTTGTCCAAGG - Intergenic
1081991138 11:47338268-47338290 CTCTCTGCTCAGTGCTCCCACGG + Intronic
1083597045 11:63922910-63922932 CTGGGTGCTCTGCTCTGCCAGGG + Intergenic
1083959496 11:66006750-66006772 CTGCCTTCTCACCTCTCCCTTGG + Intergenic
1084520147 11:69657844-69657866 CTGGCTTCTCTGGACTCCCATGG - Intronic
1084602318 11:70153243-70153265 GCGGCTGCTCAACTCTGCCATGG + Intronic
1086932447 11:92707274-92707296 TTGACTGCTCTGCTCACCCATGG + Intronic
1087515538 11:99154776-99154798 CTGTCTGCTATCCTCTCCCAAGG - Intronic
1088588637 11:111381117-111381139 CTCGCTGGTCCTCTCTCCCACGG + Intronic
1089213341 11:116820859-116820881 GGGGCAGCTCAGCTCTCCAAAGG + Exonic
1089533892 11:119149312-119149334 CGGGATGCTCAGCGCTGCCACGG - Exonic
1090867876 11:130718328-130718350 TTGACAGCTCAGCTGTCCCATGG + Intergenic
1091106021 11:132920601-132920623 CTGGCTGCAGCTCTCTCCCAGGG - Intronic
1091141627 11:133240092-133240114 CGTGCTGCTCAGGCCTCCCAGGG + Intronic
1091314135 11:134598757-134598779 ATGGATGCTGAGATCTCCCAGGG - Intergenic
1091553475 12:1554346-1554368 CTGGCTTCTCTGCTCTGCCCAGG - Intronic
1091593158 12:1857340-1857362 CTGGCTGCTTTGCTCTGCCCTGG - Intronic
1091652014 12:2317885-2317907 CTGCATCCTCACCTCTCCCAGGG - Intronic
1091749584 12:3014117-3014139 AGGGCTGGTCAGCTGTCCCAGGG - Intronic
1093496482 12:19763477-19763499 CTGTCTGCTGGCCTCTCCCAGGG + Intergenic
1094125461 12:27018384-27018406 TTTGCTTCTCAGCTCTCCAATGG - Intergenic
1096181915 12:49555867-49555889 CTGGCCCCTCTGCTCCCCCACGG + Exonic
1096592780 12:52672782-52672804 CTGGCTGCTCAGGGCCTCCATGG - Intergenic
1096707144 12:53429474-53429496 CTGGCTGCTCAGATCTCGGTGGG - Exonic
1100401407 12:94233259-94233281 CTTGCTGCTCCCCTCTCCCCAGG - Intronic
1101409630 12:104457667-104457689 CTGGCTGCCCAGATCTACCCGGG + Intronic
1101842392 12:108337580-108337602 TTGTCTGCTAGGCTCTCCCAGGG - Intronic
1103731621 12:123031664-123031686 CTGGCTGGGCAGCTCTCCTCTGG - Intronic
1103878774 12:124149877-124149899 TTGGCAGCTCAGCCCTGCCATGG - Intronic
1103912440 12:124359898-124359920 CTTGCAGCTCAGCTCCCGCAGGG - Intronic
1103925629 12:124422225-124422247 CTGGCCGTGCAGCTCTCCCTGGG + Intronic
1104098338 12:125582178-125582200 CAGTTTTCTCAGCTCTCCCAAGG - Intronic
1104373610 12:128245267-128245289 TTGTCTCCTCTGCTCTCCCATGG + Intergenic
1104813095 12:131629898-131629920 CCGGCTCCTCCGCTCTCCCCAGG + Intergenic
1104963243 12:132498025-132498047 CGGGCCCCCCAGCTCTCCCAGGG - Intronic
1106186698 13:27415925-27415947 GTGACTGCTCACCTCTGCCAGGG + Intergenic
1106383997 13:29266772-29266794 CTGGCTGCAAATCTGTCCCAGGG - Intronic
1108902901 13:55435220-55435242 CTGTCTGCTCTCCTCTCCCAGGG + Intergenic
1108978767 13:56483468-56483490 CTGTCTGCCAACCTCTCCCAGGG - Intergenic
1110494377 13:76149127-76149149 CAGGCTGCTCAGCTCTGTCAGGG + Intergenic
1110626180 13:77658634-77658656 CTGGCTGATGAGCTATCACAGGG - Intergenic
1111237889 13:85432049-85432071 CTTGCTGCTCTGCTCACCCTTGG + Intergenic
1111783949 13:92764095-92764117 ATGGCTACTCAGCTCAGCCAAGG + Intronic
1112186511 13:97133202-97133224 CCCTCTGCTCAGCTCTCACAGGG + Intergenic
1112657714 13:101469813-101469835 CTGCCTGCTTAGTTTTCCCAAGG - Intronic
1112739176 13:102454509-102454531 CTGCCTCCTCAGCTCTGCCAGGG - Intergenic
1113168650 13:107472787-107472809 CTGGCTCCTCAGCTTGCACACGG + Intronic
1113350357 13:109523644-109523666 CTGACTGCTCCTCTCACCCACGG + Intergenic
1113808299 13:113122645-113122667 CTGGCCGCCCAGCTCTGCCTGGG + Intergenic
1113910756 13:113840154-113840176 CTGGGAGCTCAGACCTCCCAGGG + Intronic
1114615468 14:24065660-24065682 TTGGCTGCTGTGCTGTCCCAGGG - Exonic
1114722772 14:24899861-24899883 CTGGCTGTTCAGCTCTTGAATGG + Intronic
1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG + Intergenic
1115162500 14:30411698-30411720 CTGGCTGGACAGCTCTTTCAAGG - Intergenic
1115777502 14:36731837-36731859 CTGGCTGCCCTGCTCTCCCCTGG + Intronic
1118224211 14:63883995-63884017 CCCGCTTCTCAGCTCTCCCTGGG - Intronic
1119286364 14:73458270-73458292 CTGGCTGCGGAGTTCTCCCGAGG - Intronic
1119713878 14:76844513-76844535 CAGGTTGCCCAGATCTCCCAGGG - Intronic
1120171026 14:81247468-81247490 ATGGCTGCTCAGCTGGCTCAGGG + Intergenic
1120402984 14:84055677-84055699 CTGGTTGCTGTGCCCTCCCACGG + Intergenic
1120596363 14:86442271-86442293 CTGGCTCCTCAGCTTGCCGACGG - Intergenic
1120931567 14:89854304-89854326 CTCTCTGCCCAGCTCTCCTATGG - Intronic
1121008208 14:90503852-90503874 CTGCCTGCTCACCTCCCCCAAGG - Intergenic
1121267566 14:92614213-92614235 ATGGCTGCACAGCTCACCCAAGG - Intronic
1121415674 14:93777780-93777802 CTGGAATCTCAGCCCTCCCAGGG - Intronic
1121619815 14:95338345-95338367 GTGGCCCCTCATCTCTCCCATGG + Intergenic
1122025507 14:98873026-98873048 CAGGCTGTTCATCTCTCCCCTGG + Intergenic
1122090274 14:99333996-99334018 CTGTCCGCTCAGCACTGCCAGGG - Intergenic
1122648376 14:103210061-103210083 CTGTCTGCTCAGCACCACCAAGG + Intergenic
1122859941 14:104577996-104578018 CCGGCAGCTCAGCACTCCCCTGG + Intronic
1122981430 14:105193921-105193943 CTGGCAGGTCAGATGTCCCATGG - Intergenic
1123119102 14:105908818-105908840 CTGGCTGCCCTGCTGTCCCTGGG - Intergenic
1123121324 14:105918375-105918397 CTGGCTGCCCTGCTGTCCCTGGG - Intronic
1123123725 14:105929975-105929997 GTGGCTGCTCAGTGTTCCCAGGG + Intronic
1123404048 15:20010039-20010061 CTGGCTGCCCTGCTATCCCTGGG - Intergenic
1123406357 15:20021466-20021488 GTGGCTGCTCAGCGTTCCCAGGG + Intergenic
1123513387 15:21016685-21016707 CTGGCTGCCCTGCTATCCCTGGG - Intergenic
1123515687 15:21028114-21028136 GTGGCTGCTCAGCGTTCCCAGGG + Intergenic
1125009716 15:34857819-34857841 CTTGCTGCTCCCTTCTCCCATGG - Intronic
1125741485 15:41967932-41967954 CAGGCTGAGGAGCTCTCCCAGGG - Intronic
1127161535 15:56192295-56192317 CTGGCTGGTAAGCGCTCACAGGG + Intronic
1127498695 15:59536340-59536362 CTGGCTGCTCAACTAGACCATGG + Intergenic
1127581363 15:60341894-60341916 CTGGAAACCCAGCTCTCCCAGGG + Intergenic
1128159033 15:65411042-65411064 CTGGCTGGCCAGCACTCCGAGGG + Exonic
1129200858 15:73998368-73998390 CTGGTTGCGCAGCTCTGCTAGGG - Exonic
1129252117 15:74314822-74314844 CTGGCATCTCTGCTCTCACATGG + Intronic
1129454732 15:75670602-75670624 CTGGCTGCCCTGCTCCTCCATGG + Intergenic
1130026664 15:80276486-80276508 CTGGATATTCAGCTCTCCCTTGG + Intergenic
1130997276 15:88911020-88911042 CATGCCGCTGAGCTCTCCCAGGG + Intronic
1131640086 15:94283225-94283247 CTGTCTGCTGGCCTCTCCCAGGG - Intronic
1132602738 16:781289-781311 CCGGCTGCTCAGCTCTGCAGTGG + Intronic
1133223596 16:4329460-4329482 GGGGCTGCCCACCTCTCCCAAGG - Intronic
1136093084 16:27934653-27934675 CTGGAGCCACAGCTCTCCCATGG - Intronic
1136113294 16:28078584-28078606 CTGGCTGTTCAGCTCTGCCCTGG - Intergenic
1137665735 16:50247926-50247948 GAGGCTGCTGAGCCCTCCCAGGG + Intronic
1137785039 16:51131627-51131649 CTGGCTGCTCACCTCGCCAAGGG - Intergenic
1138197020 16:55059342-55059364 CTGGCTGCTGTGCTACCCCAGGG - Intergenic
1138492496 16:57384492-57384514 GTGGCAGCTCACCTCTCCCTTGG + Exonic
1138776420 16:59729301-59729323 CTGTCTGCTGGCCTCTCCCAGGG + Intronic
1141275696 16:82585902-82585924 CTGGCTGCTGGGACCTCCCAGGG + Intergenic
1141950347 16:87335557-87335579 CGGGCAGCTCAGCTCAACCAGGG + Intronic
1141963398 16:87424615-87424637 CTTTTTGCTCAGCTCTCCCCTGG + Intronic
1142207016 16:88788295-88788317 CTGGCTTTTCCTCTCTCCCAAGG - Intergenic
1144302847 17:13939048-13939070 CTGGCTGCTCAGCAGCCCCCAGG + Intergenic
1144371231 17:14593842-14593864 CTGTCTGCACAGCACCCCCATGG - Intergenic
1146169243 17:30620740-30620762 CTGTGTGCTCATCTCTGCCAGGG + Intergenic
1146170319 17:30626709-30626731 CTGTGTGCTCATCTCTGCCAGGG - Intergenic
1146343773 17:32042739-32042761 CTGTGTGCTCATCTCTGCCAGGG - Intronic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147642940 17:42016105-42016127 CTGGCTTCTCTGATATCCCAGGG + Intronic
1147973035 17:44230062-44230084 CTGCCTGCTCAGCTCTATCCTGG - Intergenic
1148706035 17:49633451-49633473 CTGGCTGCTAAGGTCTCCTTGGG - Intronic
1148742370 17:49900079-49900101 CAGGCTGGCCTGCTCTCCCAGGG + Intergenic
1148866334 17:50630695-50630717 CGGGCTGCTCAGCTGGCCCAAGG - Intergenic
1151173225 17:72265953-72265975 CTGTCTGCTAAGCCCTTCCAAGG - Intergenic
1151212468 17:72554835-72554857 CTGTCTTCTCAGCACCCCCAGGG - Intergenic
1151298245 17:73201686-73201708 ATGGGGGCACAGCTCTCCCAGGG - Exonic
1151733686 17:75925764-75925786 CTGGTTTCTCAGCCCTCTCATGG - Intronic
1152310659 17:79547901-79547923 CTGGCTGCTCAGCCCACTGAAGG - Intergenic
1152312829 17:79561302-79561324 CCGGCTGCTCAGCCCTGGCAAGG - Intergenic
1152417500 17:80172018-80172040 CTGGCTGTCCAGAACTCCCAGGG + Intronic
1153321543 18:3778773-3778795 CTTCCTGGCCAGCTCTCCCAGGG - Intronic
1154381665 18:13857205-13857227 CTAGCAGCTGAGCCCTCCCAAGG + Intergenic
1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG + Intronic
1157980017 18:52368860-52368882 CTTGATGCTCAGCCCTCCCTTGG - Intronic
1158865459 18:61634040-61634062 CTGGTTCCTGAGCTCTCTCATGG - Intergenic
1159177124 18:64851915-64851937 CTGGCTCCTCAGCTCACAAACGG + Intergenic
1159235450 18:65666907-65666929 CTGGTTGCCCAGTTCTCCAAAGG + Intergenic
1159961174 18:74556805-74556827 CTGGCTCCCCAGCTCTGCCCAGG - Intronic
1160143262 18:76345208-76345230 CTGCCTCCTCTGTTCTCCCAGGG + Intergenic
1160258347 18:77266367-77266389 CTGTCTTCTCAGCACCCCCAAGG + Intronic
1160550256 18:79690267-79690289 CTGGCCTCTCAGCTCTCTCAGGG - Intronic
1160834733 19:1119351-1119373 CGGGCTGCCCAGCACTCCCAGGG - Intronic
1161201912 19:3019705-3019727 GAGGCTGTTCAGCTCCCCCACGG + Exonic
1162734492 19:12738518-12738540 CTGGCAGTCCAGCTCTCCAAGGG + Exonic
1163060257 19:14755578-14755600 CTTGCTGCTCAGCTCAGCCCTGG - Intronic
1165231429 19:34389571-34389593 GTGACTTCTCAGTTCTCCCAAGG - Intronic
1166348908 19:42184773-42184795 CTGTCTGGGCTGCTCTCCCAGGG + Intronic
1166524703 19:43503959-43503981 CCTGCTGCTCAGCTCCCCCGCGG + Exonic
1166581149 19:43901215-43901237 CTGGCTCCTCGGCGCTTCCAAGG + Intronic
1166862698 19:45819122-45819144 CTGCCTGCTCAGCCACCCCAAGG + Intronic
1166943107 19:46379851-46379873 ATATCTGCTCAGTTCTCCCAAGG - Intronic
1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG + Exonic
925878844 2:8333707-8333729 CTGGGTGCTCTGATCTGCCAGGG + Intergenic
926744882 2:16143102-16143124 GTGGCTGCACTGCTCACCCAAGG - Intergenic
927006996 2:18861359-18861381 CTGTCTGCTGGCCTCTCCCAGGG - Intergenic
927920986 2:26971359-26971381 CTGGCTGCTCAGAGCTTGCAGGG + Intronic
928097537 2:28413647-28413669 CTGGCTGCTCACCTCCCCGCAGG + Exonic
928407289 2:31024336-31024358 CTGGCTGCACAACTCACTCACGG + Intronic
928621389 2:33091806-33091828 CTGCCTCCTGAGCTCTTCCAGGG + Intronic
929820481 2:45269429-45269451 CTGGCTTTTAAGATCTCCCAAGG - Intergenic
931672919 2:64665070-64665092 CTGTTTCCTCAGTTCTCCCAAGG + Intronic
931964226 2:67515758-67515780 TTTGCTGCTCAGCTCACCCATGG + Intergenic
932201207 2:69829891-69829913 CCGGCTGCTCAACGATCCCATGG - Exonic
932711365 2:74066702-74066724 CTGGCTGGTCAGGTTTCCCTGGG - Intronic
934883730 2:98006389-98006411 CTGGTTGCTCAGCATTTCCATGG + Intergenic
936038797 2:109133109-109133131 CTGTCTGCCCAGCTCTCAGAAGG + Intronic
937802142 2:126092434-126092456 CTTGCTGCTCAGGTGCCCCATGG + Intergenic
937976171 2:127583336-127583358 CTGGGATCTCAGCCCTCCCAGGG + Intronic
938225052 2:129608667-129608689 CTGGCTTATCAACTCTCCCCAGG - Intergenic
939461595 2:142503401-142503423 CTGGCTGCTCATTTCTGGCAGGG - Intergenic
941054929 2:160776869-160776891 TTGTCTGCTGATCTCTCCCAGGG + Intergenic
941714494 2:168749436-168749458 CTGTCTTCTCAGCACTTCCAGGG + Intronic
941724523 2:168846819-168846841 CTGCTTTCTCAGTTCTCCCAAGG + Intronic
942262590 2:174184045-174184067 CTGGCTGCTCAGCTGTCCATAGG + Intronic
942863769 2:180647855-180647877 CTGGGAGCTCAGCTGTTCCATGG + Intergenic
942901058 2:181119060-181119082 CTGGCTGAACATCTGTCCCAGGG + Intergenic
943455545 2:188102956-188102978 TAGTCTGCTCATCTCTCCCAGGG + Intergenic
944268970 2:197760037-197760059 CAGGCTGCTCAGCTGTCCTGGGG - Intronic
945663484 2:212714349-212714371 CTGTCGGCTCAGTTTTCCCAAGG - Intergenic
945915758 2:215702303-215702325 TCGACTGCTCAGCTCTGCCATGG + Intergenic
946044190 2:216807553-216807575 CTGCCTGCTTCGGTCTCCCAAGG + Intergenic
946130035 2:217599617-217599639 CTGGGTGCTGAGCTGTGCCATGG - Intronic
948674592 2:239589443-239589465 CTACCTGCTGAGCTCTGCCAGGG + Intergenic
1168796172 20:611456-611478 CCTGCTGCTCAGCTCTCTCCAGG + Intergenic
1168851805 20:982015-982037 TGGGCTGCTCAGCACCCCCAGGG - Intronic
1170473483 20:16691144-16691166 GTGGGTGCTCAGCACCCCCATGG - Intergenic
1170579139 20:17684776-17684798 CAGCCTCGTCAGCTCTCCCAAGG + Intergenic
1170768188 20:19309854-19309876 CTGGAAGCCCAGCTCTCCCAGGG - Intronic
1171293068 20:23993700-23993722 CTGCCTGGTCAGCTCTCTCGGGG - Intergenic
1172408140 20:34704360-34704382 CGGGCTGCTGAGCTCGCCCGCGG - Exonic
1173085207 20:39909474-39909496 CTGCCTCCTCTTCTCTCCCAGGG - Intergenic
1173207471 20:41006305-41006327 CTCGCTGCTCCGCTCGCCCTTGG - Intergenic
1173997078 20:47346524-47346546 CTGGCTGCTGATCTCTGGCAGGG - Intronic
1178583640 21:33855808-33855830 CATGCTGCTCAGCTGCCCCAGGG + Intronic
1179470278 21:41605665-41605687 CAGCCTGCTCTGCTCACCCACGG - Intergenic
1180824126 22:18851415-18851437 CTGCCTGGTCAGCTCTCTCGGGG - Intronic
1181124552 22:20694569-20694591 CTGCCTGGTCAGCTCTCTCGGGG - Intergenic
1181188611 22:21123133-21123155 CTGCCTGGTCAGCTCTCTCGGGG + Intergenic
1181210589 22:21287360-21287382 CTGCCTGGTCAGCTCTCTCGGGG - Intergenic
1181306532 22:21920321-21920343 CTGCCTGCTCAGCTCACACAAGG + Exonic
1181398923 22:22639531-22639553 CTGCCTGGTCAGCTCTCTCGGGG + Intergenic
1181473120 22:23152881-23152903 CTGGCTGCCCTGCCCACCCATGG + Intronic
1181501654 22:23318877-23318899 CTGCCTGGTCAGCTCTCTCGGGG + Intergenic
1181650498 22:24256528-24256550 CTGCCTGGTCAGCTCTCTCGGGG - Intergenic
1181706883 22:24654210-24654232 CTGCCTGGTCAGCTCTCTCGGGG + Intergenic
1182698203 22:32210314-32210336 CTGGGTGATCCCCTCTCCCATGG - Intergenic
1182786438 22:32911657-32911679 ATGGCTGCACGGCTCTCCCCGGG + Intronic
1183363817 22:37396762-37396784 CTGGCTGCTCAGATCGCGCTCGG + Intronic
1183374902 22:37457465-37457487 CTGGCTTCTCACCTGGCCCAGGG - Intergenic
1183784505 22:40021685-40021707 CTTCTGGCTCAGCTCTCCCAAGG - Exonic
1183922223 22:41178181-41178203 CTGGGGGCTCATCCCTCCCATGG - Exonic
1184663641 22:45976652-45976674 CTGGCTGCTGCCCTCGCCCACGG + Intronic
1184891468 22:47382033-47382055 CTGCCTGCCCTCCTCTCCCACGG - Intergenic
1185088507 22:48753345-48753367 CTGGTGGCTCAGCTGGCCCAGGG - Intronic
1203216359 22_KI270731v1_random:8070-8092 CTGCCTGGTCAGCTCTCTCGGGG + Intergenic
1203274264 22_KI270734v1_random:77319-77341 CTGCCTGGTCAGCTCTCTCGGGG - Intergenic
949376949 3:3401013-3401035 CTGTCTGCTGGCCTCTCCCAAGG - Intergenic
949541047 3:5032256-5032278 CTGTCTGCTCAGCTCTAACATGG - Intergenic
949977059 3:9470564-9470586 CTGGCTCCTCATCCCTCCCTCGG + Exonic
950144838 3:10641651-10641673 CTGGTTGCTCAGCTCTAACTTGG + Intronic
951036456 3:17938317-17938339 CTGCCTGCCCTGCTCTACCAAGG + Intronic
951661567 3:25072390-25072412 CTGGTTGCTCAGCTCCACCATGG - Intergenic
951778878 3:26340756-26340778 GTAGCTGCTCAGCTCAGCCAGGG + Intergenic
951799847 3:26583600-26583622 CTGGATGCTCAGAATTCCCAGGG - Intergenic
954037168 3:47857359-47857381 CTGGCTGCCCAGCTGACCCATGG + Intronic
954431223 3:50471822-50471844 CTGTCTGCTCAGCACTCCTCAGG - Intronic
954611112 3:51945013-51945035 TTGCTTGCTCAGCTTTCCCAGGG - Exonic
954624591 3:52015690-52015712 CCTCCTGCTCAGCTCTTCCAGGG - Intergenic
954652976 3:52176447-52176469 CTGGCTGCTCAGCCTCCCCCAGG + Intergenic
959929165 3:111959758-111959780 CTTGCTCCTCAGATCTTCCAAGG - Intronic
960103392 3:113768486-113768508 CTGCCTGCTTAGCTCCCTCAAGG + Intronic
961370275 3:126424425-126424447 GTGGCTGCCCAGCTCTCACCTGG + Intronic
961558176 3:127710871-127710893 CTGCCTGGCCAGCTCCCCCAAGG - Intronic
963461280 3:145617434-145617456 CTGGCTGCTGCCCTCCCCCAGGG + Intergenic
963559510 3:146845094-146845116 CTGTCTGCTCATGTCTGCCATGG + Intergenic
965678524 3:171225545-171225567 CTGCCTTCTCAGTTCTTCCAAGG - Intronic
965682490 3:171265910-171265932 TTGGCTGTTCAGTTATCCCATGG + Intronic
966800461 3:183758885-183758907 ACGGCTTCTCAGGTCTCCCAAGG + Exonic
968028341 3:195461991-195462013 CTGGCAGGTCAGCTGTTCCACGG - Intergenic
968582218 4:1400450-1400472 ATGGCTCCCCAACTCTCCCAGGG + Intergenic
968891578 4:3372201-3372223 CTGTCTGCGCACCCCTCCCAGGG + Intronic
968900457 4:3429088-3429110 CTGGGTGCCCAGCTCTGCCTAGG - Intronic
969258209 4:6017300-6017322 CTGGCTGCTCTGCCCTGCCCTGG - Intergenic
969350837 4:6597027-6597049 CCAGCTTCTCAGCTCTTCCAGGG + Intronic
969910605 4:10441830-10441852 CCTGCTGCTCAGCTTTCTCAGGG - Exonic
970212327 4:13722494-13722516 AAGGCTGCTCAGCTCTGCCAAGG + Intergenic
971539937 4:27803380-27803402 CTAGCTTCTCAGGTTTCCCACGG + Intergenic
971774517 4:30945644-30945666 CTGACTGATAAGCTCACCCAGGG + Intronic
973129859 4:46637097-46637119 CTTGCTGCTCAGCTTGCCGAGGG - Intergenic
975846815 4:78533929-78533951 CTGGCAGATAAGCGCTCCCAAGG - Intronic
978012042 4:103699450-103699472 ATGGCTCCTTAGCTCTCTCAGGG - Intronic
978619016 4:110621447-110621469 CAGGCAGCCCAGCTCTTCCACGG - Intronic
980123828 4:128754297-128754319 CAGGCTGCTCATCTCCCTCATGG - Intergenic
980708037 4:136524716-136524738 CTGGTAGCTCAGCTCTCTCCAGG + Intergenic
981586702 4:146311027-146311049 CTGGTTTCTCGACTCTCCCAAGG + Intronic
982673194 4:158347006-158347028 CAGGGTGGTCAGCTCTCCAAAGG - Intronic
982721373 4:158863472-158863494 ATGGCTGCTCAGCACTACCAGGG + Intronic
985881648 5:2642901-2642923 CAGACTGCTCAGCTCTCCTGTGG + Intergenic
987433249 5:17862614-17862636 TTGGCTGCTGAGCTCTCTCGGGG - Intergenic
989178670 5:38556015-38556037 CTGGCAGGTCACCTCTCCGAAGG + Intronic
989339016 5:40353935-40353957 CTGGCTTCTCAGCGCTTCCACGG + Intergenic
992614276 5:78534380-78534402 CAGGCTGCACTGCTCTTCCAGGG + Intronic
996525537 5:124475263-124475285 TGGGCTGCTGAGCTCTCCCAAGG + Intergenic
996640299 5:125743738-125743760 CTTGCTGCCCAGATCTCTCATGG + Intergenic
997201132 5:132010957-132010979 CTGGCTCCTCTGCTCTGCCCAGG - Intronic
997211700 5:132080721-132080743 CTGGGTGCTCAGAGGTCCCAAGG + Intergenic
997612942 5:135227848-135227870 CTGTCTGCTCTGCTCTCACAAGG + Intronic
998621176 5:143795904-143795926 CTGGGTGCTCTGCCCTCCTAGGG - Intergenic
999327221 5:150650762-150650784 CTGCCTCCTCAGCTGCCCCAGGG + Exonic
1000327428 5:160182989-160183011 CTGTCTGCTGAGCCCTCCAAGGG + Intergenic
1000427758 5:161113055-161113077 CTGGATGCTAAGCTCAGCCATGG + Intergenic
1000655784 5:163876366-163876388 CTGGCTCAGCAGCTCTCACAAGG + Intergenic
1001438678 5:171721015-171721037 AGGGCTGCTGGGCTCTCCCACGG + Intergenic
1001679026 5:173542843-173542865 CTGGCTCTACATCTCTCCCAAGG + Intergenic
1001892815 5:175353296-175353318 CTGGCTTCCCAGTCCTCCCAGGG - Intergenic
1002710817 5:181193969-181193991 CTCCCTGCTCAGCGCTCCCCTGG - Exonic
1004188163 6:13440128-13440150 CAGGCTGTTCAGTTCTTCCACGG + Intronic
1004287914 6:14339644-14339666 CTGGGTGCCCTCCTCTCCCACGG + Intergenic
1004806813 6:19211497-19211519 CTGGCTTCTGGCCTCTCCCAAGG - Intergenic
1005615375 6:27567531-27567553 CTGCCTTCTCTGCTCTCACAGGG + Intergenic
1005923249 6:30418668-30418690 CTGGCTGCTCAGGGCTCGGAGGG + Intergenic
1005971330 6:30764152-30764174 CTGGCTTCTCAGCTGCCCCCCGG - Intergenic
1006437610 6:34034345-34034367 CTGGCTGGTCAGGTTTCCAATGG - Intronic
1007334978 6:41149501-41149523 CTGGTTGCTCAGATATCCTAAGG + Intronic
1007399848 6:41597518-41597540 CTGGCTTATCCCCTCTCCCAGGG - Intronic
1007491486 6:42226396-42226418 TTGGCTGATCGTCTCTCCCAGGG - Exonic
1011115996 6:83892527-83892549 CTCAATGCACAGCTCTCCCAAGG - Intronic
1015127112 6:129767396-129767418 CTGCCGGCTCAGCGCTCGCACGG - Intergenic
1015732210 6:136360838-136360860 CGGGCTGCCCGGGTCTCCCAGGG + Intronic
1017910082 6:158785042-158785064 CTGACTGCTCAGCTCCTCCTGGG - Intronic
1018262772 6:161986769-161986791 CTGGCTGTTCCGCTCTCACTTGG - Intronic
1018611278 6:165649856-165649878 CTGGCTGGGCAGCTCTCCAGTGG + Intronic
1019125875 6:169839889-169839911 CTGGCTGCCCTTCTCTCCCAGGG + Intergenic
1019715903 7:2539224-2539246 CTGGCTGGACAGCTGCCCCATGG + Exonic
1019896500 7:3987562-3987584 CTGTGTGCACAGCCCTCCCATGG - Intronic
1019900297 7:4015265-4015287 CTGGTTCCTCAGCTCTTCCCTGG + Intronic
1022521838 7:31013487-31013509 CCGCCTTCTCAGCTCTGCCAAGG + Intergenic
1022942020 7:35250148-35250170 CAGGCTGGTCAGCTCACCCAGGG + Exonic
1023876651 7:44289783-44289805 CAGGCTGCTGAGCTCCCGCAGGG + Intronic
1025854451 7:65265225-65265247 GAGGTTCCTCAGCTCTCCCAAGG - Intergenic
1026900846 7:74036665-74036687 CTTGATGCTCGGGTCTCCCAGGG - Intronic
1027175244 7:75899226-75899248 CTGGCTGGTCAGCCCTGCCTGGG + Intronic
1027443601 7:78246389-78246411 ATGGCTGCTCAGCTTCACCAGGG - Intronic
1029421943 7:100476479-100476501 CTGGCTGCTCACCCCCACCATGG + Intronic
1031872432 7:127101954-127101976 CTGGCTGCTGAGGTCTCAGATGG + Intronic
1031970089 7:128058465-128058487 CTGGCTGCAGAGCTCTCACTGGG + Intronic
1031979151 7:128113179-128113201 CTGGGTGCCCAGCTCTGGCATGG - Intergenic
1033416030 7:141162006-141162028 CTGGCTGCTCAGCGCTGGGAAGG - Intronic
1033431501 7:141293591-141293613 CTTGATTCTTAGCTCTCCCATGG - Intronic
1033454646 7:141491863-141491885 CTGCCTCCTCATCTCTCCCCTGG + Intergenic
1033542760 7:142372454-142372476 CTGCCTGCTCCGCTGTGCCATGG + Intergenic
1034830446 7:154303808-154303830 GTGGCTGGTCACCTCTACCATGG - Intronic
1035289736 7:157830178-157830200 CTGGCAGCTGAGCACCCCCAGGG + Intronic
1035565458 8:637840-637862 CTGGCTGCTGTGCTCTCGCACGG - Intronic
1036387827 8:8297167-8297189 CTGGGTGCTCAGCCCTCAAAGGG - Intergenic
1036621617 8:10427805-10427827 CTGGCCCCAAAGCTCTCCCAGGG - Intronic
1036641552 8:10587437-10587459 AGGGCTGCACAGCTTTCCCATGG - Intergenic
1038585030 8:28780625-28780647 CTGGATGCCCAGCTGTCCAATGG + Intronic
1039115215 8:34085093-34085115 CTGGCTTCTCATCTTTCCCTTGG + Intergenic
1040296453 8:46151530-46151552 GTGGGTGCTCGGCTTTCCCAGGG - Intergenic
1043147728 8:76678090-76678112 CTGGCTGCTCCGCTGTGCCGCGG - Intergenic
1043172794 8:76986446-76986468 CTGGCTGCTCTCCTCTCTCATGG + Intronic
1045325105 8:101112106-101112128 CTGACTGGACAGCTCTCCCTGGG + Intergenic
1045962090 8:107980162-107980184 CTGGCTGCTCAGGGAACCCATGG - Intronic
1046023843 8:108698952-108698974 CTGTCTGGTCAGCTTTTCCAGGG - Intronic
1048086409 8:131185636-131185658 CAGGCTGCTGAGGTCTCCGAAGG + Intergenic
1049197611 8:141324296-141324318 ATGGCTGCTCCGCCCACCCAGGG + Intergenic
1049296898 8:141845529-141845551 CTGGTCGCTCAGCCCTCCCCGGG - Intergenic
1049616133 8:143576515-143576537 CCGGTAGCCCAGCTCTCCCAGGG + Exonic
1049648919 8:143754352-143754374 CTGGCTGAGCACCTCTCCCAGGG + Intergenic
1049674108 8:143882247-143882269 ATGGCTGTGCTGCTCTCCCATGG - Intergenic
1051096981 9:13477452-13477474 CTATCTGCTGACCTCTCCCAGGG - Intergenic
1051946996 9:22581261-22581283 CTGTCTGCTGATTTCTCCCAAGG - Intergenic
1052855178 9:33402518-33402540 CCTGCCTCTCAGCTCTCCCAGGG + Exonic
1053375280 9:37600822-37600844 CTGTCTTCTCAGATGTCCCATGG + Intronic
1053414243 9:37936836-37936858 CTGGCTGTTCAGTTTTCCCTTGG - Intronic
1053722385 9:40959824-40959846 CTGGCTGCTTTTCTCTACCATGG - Intergenic
1054343584 9:63892174-63892196 CTGGCTGCTTTTCTCTACCATGG + Intergenic
1055401920 9:75933081-75933103 CTTGCTTCTAGGCTCTCCCAGGG - Intronic
1056578076 9:87870874-87870896 GCGGCTGCTCTGCTCTCCCTGGG - Intergenic
1057569125 9:96190377-96190399 CTGGCAGCTCAGGGCTCCAAAGG + Intergenic
1058041521 9:100307344-100307366 ATGGCTACTCAGCACTACCACGG - Intronic
1060447572 9:123705934-123705956 CTGTTTTCTCAGTTCTCCCAAGG - Intronic
1060826032 9:126688599-126688621 CTGGCTGTCCAGCTCTCCCGAGG - Intronic
1061238081 9:129353477-129353499 CGGCCTGCGGAGCTCTCCCAAGG + Intergenic
1061785117 9:133023235-133023257 CTGTCTGCTGAGGTGTCCCAAGG - Intergenic
1062166954 9:135112700-135112722 CTTGCTGCTGAGCTCTCCCAGGG - Intronic
1187119580 X:16391533-16391555 ATTTCTGCTCAGCTCTCCCCCGG + Intergenic
1187488228 X:19724877-19724899 CTGGGTGCTGTGCTCTCTCATGG - Intronic
1189653114 X:43211279-43211301 CTGTCTGCTGGCCTCTCCCAGGG + Intergenic
1190303957 X:49072100-49072122 CTGGCTGCTCACCACTCCATTGG - Intronic
1190371668 X:49748495-49748517 CTGGACGTTCAGCTCCCCCAAGG - Intergenic
1190936510 X:55003022-55003044 CTAGCCGCTCAGGCCTCCCAGGG - Exonic
1192211888 X:69133007-69133029 CTGTCTCATCAGCTCTCCTAGGG + Intergenic
1194141081 X:90210402-90210424 CCAGCTTCACAGCTCTCCCATGG - Intergenic
1195131910 X:101861561-101861583 CTAGATGTTCAGCTGTCCCAGGG - Intergenic
1196379044 X:115069130-115069152 CTGCCTGCGCAACCCTCCCAGGG + Intergenic
1198565210 X:137897033-137897055 CTGGCTGCTCAGCTTGCAGACGG + Intergenic
1199516346 X:148680748-148680770 CTGTCTGCTCTGGGCTCCCAGGG - Intronic
1199600867 X:149540419-149540441 CTCCTCGCTCAGCTCTCCCACGG + Intronic
1199640710 X:149858459-149858481 CTGTCTGCTCTCATCTCCCAGGG + Intergenic
1200808051 Y:7452705-7452727 CTTGCTGCTGCGCTCTTCCAAGG - Intergenic