ID: 1167758597

View in Genome Browser
Species Human (GRCh38)
Location 19:51428806-51428828
Sequence CGGGCTCATGGCCCATTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167758597_1167758604 1 Left 1167758597 19:51428806-51428828 CCAAGAAATGGGCCATGAGCCCG No data
Right 1167758604 19:51428830-51428852 AAATGCAGGTGGCCACTGAACGG No data
1167758597_1167758605 10 Left 1167758597 19:51428806-51428828 CCAAGAAATGGGCCATGAGCCCG No data
Right 1167758605 19:51428839-51428861 TGGCCACTGAACGGTAGAAAAGG No data
1167758597_1167758601 -10 Left 1167758597 19:51428806-51428828 CCAAGAAATGGGCCATGAGCCCG No data
Right 1167758601 19:51428819-51428841 CATGAGCCCGGAAATGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167758597 Original CRISPR CGGGCTCATGGCCCATTTCT TGG (reversed) Intergenic
No off target data available for this crispr