ID: 1167758604

View in Genome Browser
Species Human (GRCh38)
Location 19:51428830-51428852
Sequence AAATGCAGGTGGCCACTGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167758594_1167758604 22 Left 1167758594 19:51428785-51428807 CCACGAAGTTGGCTCTGACAACC No data
Right 1167758604 19:51428830-51428852 AAATGCAGGTGGCCACTGAACGG No data
1167758597_1167758604 1 Left 1167758597 19:51428806-51428828 CCAAGAAATGGGCCATGAGCCCG No data
Right 1167758604 19:51428830-51428852 AAATGCAGGTGGCCACTGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167758604 Original CRISPR AAATGCAGGTGGCCACTGAA CGG Intergenic
No off target data available for this crispr