ID: 1167758605

View in Genome Browser
Species Human (GRCh38)
Location 19:51428839-51428861
Sequence TGGCCACTGAACGGTAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167758602_1167758605 -9 Left 1167758602 19:51428825-51428847 CCCGGAAATGCAGGTGGCCACTG No data
Right 1167758605 19:51428839-51428861 TGGCCACTGAACGGTAGAAAAGG No data
1167758603_1167758605 -10 Left 1167758603 19:51428826-51428848 CCGGAAATGCAGGTGGCCACTGA No data
Right 1167758605 19:51428839-51428861 TGGCCACTGAACGGTAGAAAAGG No data
1167758600_1167758605 -2 Left 1167758600 19:51428818-51428840 CCATGAGCCCGGAAATGCAGGTG No data
Right 1167758605 19:51428839-51428861 TGGCCACTGAACGGTAGAAAAGG No data
1167758597_1167758605 10 Left 1167758597 19:51428806-51428828 CCAAGAAATGGGCCATGAGCCCG No data
Right 1167758605 19:51428839-51428861 TGGCCACTGAACGGTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167758605 Original CRISPR TGGCCACTGAACGGTAGAAA AGG Intergenic
No off target data available for this crispr