ID: 1167762656

View in Genome Browser
Species Human (GRCh38)
Location 19:51459065-51459087
Sequence AGGCCTGAGCAGAGGGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167762648_1167762656 4 Left 1167762648 19:51459038-51459060 CCCCTAGGTCAGGGGTTCAGTCT No data
Right 1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG No data
1167762649_1167762656 3 Left 1167762649 19:51459039-51459061 CCCTAGGTCAGGGGTTCAGTCTC No data
Right 1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG No data
1167762650_1167762656 2 Left 1167762650 19:51459040-51459062 CCTAGGTCAGGGGTTCAGTCTCA No data
Right 1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167762656 Original CRISPR AGGCCTGAGCAGAGGGACAC GGG Intergenic
No off target data available for this crispr