ID: 1167764704

View in Genome Browser
Species Human (GRCh38)
Location 19:51473842-51473864
Sequence CTGAACAATCAGGATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167764704_1167764707 11 Left 1167764704 19:51473842-51473864 CCATCTTCATCCTGATTGTTCAG No data
Right 1167764707 19:51473876-51473898 CTGACCATGCACAGTCTAGATGG No data
1167764704_1167764708 14 Left 1167764704 19:51473842-51473864 CCATCTTCATCCTGATTGTTCAG No data
Right 1167764708 19:51473879-51473901 ACCATGCACAGTCTAGATGGAGG No data
1167764704_1167764710 15 Left 1167764704 19:51473842-51473864 CCATCTTCATCCTGATTGTTCAG No data
Right 1167764710 19:51473880-51473902 CCATGCACAGTCTAGATGGAGGG No data
1167764704_1167764711 18 Left 1167764704 19:51473842-51473864 CCATCTTCATCCTGATTGTTCAG No data
Right 1167764711 19:51473883-51473905 TGCACAGTCTAGATGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167764704 Original CRISPR CTGAACAATCAGGATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr