ID: 1167764707

View in Genome Browser
Species Human (GRCh38)
Location 19:51473876-51473898
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167764703_1167764707 20 Left 1167764703 19:51473833-51473855 CCAGTTCTGCCATCTTCATCCTG No data
Right 1167764707 19:51473876-51473898 CTGACCATGCACAGTCTAGATGG No data
1167764704_1167764707 11 Left 1167764704 19:51473842-51473864 CCATCTTCATCCTGATTGTTCAG No data
Right 1167764707 19:51473876-51473898 CTGACCATGCACAGTCTAGATGG No data
1167764706_1167764707 1 Left 1167764706 19:51473852-51473874 CCTGATTGTTCAGACTAGGCATC No data
Right 1167764707 19:51473876-51473898 CTGACCATGCACAGTCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167764707 Original CRISPR CTGACCATGCACAGTCTAGA TGG Intergenic
No off target data available for this crispr