ID: 1167766389

View in Genome Browser
Species Human (GRCh38)
Location 19:51485507-51485529
Sequence AGGGAGAAGAGATTGGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1020
Summary {0: 1, 1: 0, 2: 5, 3: 93, 4: 921}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1167766382_1167766389 19 Left 1167766382 19:51485465-51485487 CCAAGTGAAGTTGGGGAAACAGG 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1167766389 19:51485507-51485529 AGGGAGAAGAGATTGGGCAGTGG 0: 1
1: 0
2: 5
3: 93
4: 921
1167766378_1167766389 28 Left 1167766378 19:51485456-51485478 CCTTTGCTACCAAGTGAAGTTGG 0: 1
1: 0
2: 1
3: 8
4: 94
Right 1167766389 19:51485507-51485529 AGGGAGAAGAGATTGGGCAGTGG 0: 1
1: 0
2: 5
3: 93
4: 921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1167766389 Original CRISPR AGGGAGAAGAGATTGGGCAG TGG Intronic
900312534 1:2041129-2041151 AGGGATAAGAGATGGAGGAGAGG + Intergenic
900502830 1:3015010-3015032 AGGGAGATGGGCATGGGCAGAGG + Intergenic
900677198 1:3895080-3895102 AGGGAGGAGAGGTGGGGCAGTGG - Intronic
900829617 1:4956576-4956598 AGTGAGAAGAGATGGGACAGAGG + Intergenic
901031373 1:6308811-6308833 AGGGAAAAGCGACTGGGCGGAGG + Intronic
901089042 1:6629423-6629445 GGGGAGGACAGATGGGGCAGGGG - Intronic
901501394 1:9654595-9654617 AGGGAGAAGTGAATGTGCAACGG + Intronic
902783030 1:18716741-18716763 AGGGGGAAGAGAATGGGTAGAGG - Intronic
902852403 1:19170403-19170425 AGAGAGAAGAGAGTGGGGAGGGG + Intronic
903031003 1:20464393-20464415 TGGGAGGTGAGATAGGGCAGTGG - Intergenic
903063731 1:20686900-20686922 AGGGAGAAGATGTTGGTCAGGGG + Intronic
903381303 1:22898747-22898769 AGGGAGAAGGTAGTGGGAAGTGG + Intronic
903796054 1:25929758-25929780 AGGGAGAAGGGAAAGGGCAGAGG - Intergenic
903999844 1:27332695-27332717 TGGGAGGAGAGACTGGGCCGAGG + Intronic
904207649 1:28865178-28865200 AGGGAGAGGAGATGAGGCACGGG - Intergenic
904812458 1:33172345-33172367 GGGGAGAACAGGTTGGGTAGGGG + Intronic
904951003 1:34238745-34238767 AGGCAAAAGAGCTTGTGCAGGGG - Intergenic
904970859 1:34418466-34418488 GGAGAGAAGAGAATGGGCTGGGG - Intergenic
905093076 1:35445351-35445373 TGGGAGAAGATAATGGGCAACGG - Intronic
905292967 1:36935536-36935558 GGGGAGAAGAGATGGGGGAGGGG - Intronic
905673294 1:39807614-39807636 AGGGAGAGGGGAGAGGGCAGAGG - Intergenic
905766640 1:40607247-40607269 AGGGACAAGAGACAGGGCAGAGG - Intergenic
905974939 1:42167993-42168015 ATGGAGCTGAGGTTGGGCAGGGG + Intergenic
906225665 1:44119162-44119184 AGGGATGGGAGATTGGGGAGGGG + Intronic
906620913 1:47278001-47278023 AGGGTTAAGAGAGTGGGCTGTGG - Intronic
906793045 1:48675251-48675273 AGAGGGAAGAGATTGGGCTCAGG - Intronic
907303695 1:53502702-53502724 AGAGAGAGGAGAGTGGGGAGGGG + Intergenic
907763201 1:57382211-57382233 AGGGAGGAGACATAGGGAAGTGG + Intronic
907960882 1:59279838-59279860 AGGTGGAAGAGTTTTGGCAGCGG + Intergenic
908290759 1:62664894-62664916 AGGGAGAACAGATTCAGGAGAGG + Intronic
908979937 1:69943451-69943473 AGGGAGAGGAGAATGGGTATGGG + Intronic
909286513 1:73826893-73826915 AGGGAAAAGGGAGTGGGTAGGGG + Intergenic
910141406 1:84031046-84031068 AGGGACATGAGATTTGGGAGGGG - Intergenic
910479016 1:87638343-87638365 AGGCAGGAGAGCTTGTGCAGGGG + Intergenic
911189537 1:94933768-94933790 AGAGAGAAGAGCTTGTGCAGTGG - Intergenic
911930706 1:103899921-103899943 ATGGAGGCAAGATTGGGCAGAGG + Intergenic
912151122 1:106860026-106860048 AGGGAAGAGAGCTTGTGCAGGGG + Intergenic
912254708 1:108047039-108047061 ATGGAGAACAGATTGGAGAGGGG - Intergenic
912309140 1:108602069-108602091 ATGGAGAATAGCTTGGGCAAAGG + Intronic
912560992 1:110551473-110551495 AAGGAGAAAAGATGGGGAAGAGG + Intergenic
912630092 1:111239275-111239297 AGGGAGAACAGAGTGGACATTGG + Intronic
912687971 1:111781905-111781927 AGGGAGAAGGGACTGGGTAGAGG + Intronic
912739508 1:112180916-112180938 AAGGAGACGAGACTGGCCAGAGG - Intergenic
912838759 1:113020301-113020323 AGGGAGGAGAAAGTGGGAAGTGG + Intergenic
912940289 1:114038929-114038951 AGGAAGATGAGATGGGGCAGGGG - Intergenic
913501484 1:119476282-119476304 AGGGGGCACAGTTTGGGCAGTGG + Intergenic
915130725 1:153693719-153693741 AGGGAGGAGAGCATGGGGAGGGG - Exonic
915298581 1:154939129-154939151 AGGGCCAAGGGATTGAGCAGCGG - Intergenic
915344911 1:155192534-155192556 AGGGGGAAGAGAGTAGGGAGAGG - Intronic
915470460 1:156122894-156122916 AGGGGAAAGAGTTTGGGAAGGGG + Intronic
916063724 1:161119639-161119661 AGGTAGAAGAGCATGGGAAGAGG - Intronic
916461992 1:165034768-165034790 AGGGGGAAGTGATTGGGGAGTGG + Intergenic
917035318 1:170742174-170742196 AGGCAAAAGAGCTTGTGCAGGGG + Intergenic
917035615 1:170744396-170744418 AGGCAAAAGAGCTTGTGCAGGGG + Intergenic
917191848 1:172426399-172426421 AGGGAGAATGAATTGGGCATTGG - Intronic
917333470 1:173906076-173906098 AGGGATAGGAGATTGGACAATGG - Intronic
917727005 1:177837819-177837841 TGGGAGAAAAGACTGGGCACAGG - Intergenic
917857143 1:179110008-179110030 GAGGAGAAGAGGTTGCGCAGTGG - Intronic
919473683 1:198009608-198009630 AGGGACATGAGATTTGGGAGGGG - Intergenic
919669669 1:200327428-200327450 AGGGAGAAGTAATTGTGCTGGGG - Intergenic
919936107 1:202251842-202251864 AGGGAGAGGAGATGGGAAAGTGG + Intronic
920430029 1:205912829-205912851 GGGGAGAGAAGATTGGGCTGAGG - Intergenic
920526115 1:206667835-206667857 TGGGAGAAGGGATTGGAAAGGGG + Intronic
920692538 1:208158049-208158071 AGGGGAAAGAGAGTGGGAAGTGG + Intronic
920837255 1:209522601-209522623 AGGGAGAGGAGAAGGGGCAGAGG + Intergenic
921215607 1:212934282-212934304 AGAGAGAAGGGCCTGGGCAGTGG + Intergenic
921591088 1:217004412-217004434 AGGCAAAAGAGCTTGTGCAGGGG - Intronic
921749237 1:218773867-218773889 AGGTAGAAGAGATGGGGATGAGG - Intergenic
921766063 1:218973704-218973726 AGGGACATGAGATTTGGGAGGGG + Intergenic
921982684 1:221275202-221275224 AGGAAGAAGAGATAGGACACAGG + Intergenic
922074345 1:222228012-222228034 AGGAAAAAGAGCTTGTGCAGGGG + Intergenic
922453081 1:225752276-225752298 AGGGGGAAGAAAATGGGGAGGGG - Intergenic
922530677 1:226342637-226342659 ACGGAGATGAGATTTGGGAGGGG + Intergenic
922849813 1:228723049-228723071 AGGGAGAGGGGAATGGGGAGAGG - Intergenic
923051778 1:230395088-230395110 AGGGAGAGGAGCTTGGGGATGGG - Intronic
923778913 1:237004402-237004424 AGCGAGAAGAGAAGAGGCAGTGG + Exonic
923815879 1:237378112-237378134 AGAGACAAGAGCTTGTGCAGGGG + Intronic
924171961 1:241351709-241351731 ATGGAGGAGAGAATGGGCATAGG + Intronic
924180467 1:241435040-241435062 AGAGATAAGAGATTGGGGTGTGG - Intergenic
924181556 1:241443930-241443952 AGAGACAAAGGATTGGGCAGAGG + Intergenic
924257457 1:242196754-242196776 AGGGAGCAGAGTTAGGGCAAAGG - Intronic
1062987326 10:1780614-1780636 ACTGAGATGAGATTGAGCAGTGG + Intergenic
1063392411 10:5659179-5659201 AGGGTGCAGGGATTGGGGAGGGG - Intronic
1063621014 10:7649169-7649191 AGGGAGAAGGGAAGGGGAAGGGG - Intronic
1063940550 10:11124034-11124056 AGGCAGGAGAGCTTGTGCAGGGG + Intronic
1064420135 10:15183938-15183960 AGGCAAGAGAGCTTGGGCAGGGG + Intergenic
1064907313 10:20360800-20360822 AGGCAGGAGAGCTTGTGCAGGGG + Intergenic
1065363916 10:24916488-24916510 AGTGAGAAGAAATTAGTCAGAGG - Intronic
1066011243 10:31195470-31195492 AAGGAAGGGAGATTGGGCAGGGG - Intergenic
1066051202 10:31637459-31637481 AGGGAAAACAGAATGGGTAGTGG - Intergenic
1066058718 10:31704042-31704064 AGGGACATGAGATTTGGGAGGGG + Intergenic
1066112190 10:32207316-32207338 AGGGAGATAGGATTGTGCAGAGG + Intergenic
1067204347 10:44200474-44200496 AGGGTGAGGAGATTGGGGTGAGG - Intergenic
1067897618 10:50201103-50201125 TTGGAGAAGAGATTGGCCACTGG + Intronic
1068187727 10:53608090-53608112 AGGAAGGAAAGATAGGGCAGAGG + Intergenic
1068243123 10:54331010-54331032 AAGGAGAAGAGAAAGGGAAGGGG + Intronic
1068244243 10:54343123-54343145 AAGGACAAGAGATTTGGAAGAGG + Intronic
1068321720 10:55426824-55426846 TCGGAGAAGAAATTGGCCAGAGG - Intronic
1069783317 10:70970445-70970467 GGGGAGGAGGGAGTGGGCAGGGG + Intergenic
1070050764 10:72887383-72887405 AGGGAGAAGGAAGTGGGCGGAGG - Exonic
1070267215 10:74915398-74915420 AGGGAGCAGAGGTATGGCAGGGG - Intronic
1071916037 10:90296134-90296156 AGAGATAAGAGATTGGGGCGTGG - Intergenic
1072041249 10:91608836-91608858 AGGGAGTGGAGGTGGGGCAGGGG + Intergenic
1072702187 10:97650667-97650689 AGGGAAAAGAGATGGAGAAGAGG + Intronic
1072728016 10:97826539-97826561 TGGGAGACGAGGCTGGGCAGAGG + Intergenic
1072750437 10:97974962-97974984 GGGGAGAAGGGAGCGGGCAGTGG + Intronic
1072975865 10:100057199-100057221 AGAGAGATGAGATGGGGCATTGG - Intronic
1073176290 10:101559581-101559603 AGGGAGAAGGGGGTGGCCAGGGG - Intergenic
1073392986 10:103194136-103194158 AATGAGAAGACCTTGGGCAGAGG - Intergenic
1074020772 10:109580314-109580336 ATGGAGAAAAGATTGGGGGGGGG - Intergenic
1074239433 10:111622276-111622298 AGGGACATGAGATTTGGGAGAGG + Intergenic
1074372527 10:112911728-112911750 AGTGACAGGAAATTGGGCAGGGG + Intergenic
1075153515 10:119955791-119955813 AGGGAGGCAGGATTGGGCAGAGG + Intergenic
1075196543 10:120364416-120364438 AGGAAGAAGAAGTTGGGGAGAGG - Intergenic
1075279111 10:121123471-121123493 ATGGAGAAGAGGTGGGGGAGAGG + Intergenic
1075336553 10:121613100-121613122 AGGCAGAAGAGATGGGGTAGAGG - Intergenic
1077020197 11:413899-413921 AGGCAGAAGAGAGGGTGCAGGGG - Intronic
1077127234 11:946200-946222 GGGGAGAAGAGAATGGGAGGAGG - Intronic
1077194490 11:1272401-1272423 TGGGGGATGAGATTGGGGAGGGG - Intergenic
1077281111 11:1746696-1746718 GGAGAGAAGAGGCTGGGCAGAGG - Intronic
1077401652 11:2361150-2361172 AGGGACTACAGAATGGGCAGTGG + Intergenic
1077494613 11:2880830-2880852 AGGCAGGAGAGATAAGGCAGGGG - Intergenic
1077830331 11:5861335-5861357 AGGAGGAAGAGATTGAGAAGAGG - Intronic
1077890900 11:6417837-6417859 AGGAAGAACAGATTTGGAAGTGG + Intronic
1078573904 11:12482740-12482762 AGGCAGAAAAGCTTGTGCAGGGG + Intronic
1078611297 11:12821887-12821909 AGGGAGAAGATCTAAGGCAGAGG - Intronic
1078754835 11:14199509-14199531 AGGGAGAAAAGTTTAGGAAGTGG - Intronic
1078790962 11:14541595-14541617 GGGGAAAAGAGTGTGGGCAGTGG - Intronic
1078953274 11:16160173-16160195 AAGAAGACAAGATTGGGCAGAGG + Intronic
1078978710 11:16506578-16506600 AAGGACATGAGATTTGGCAGGGG + Intronic
1079332515 11:19545441-19545463 AGGAAGAAGGTATGGGGCAGTGG + Intronic
1079356922 11:19737440-19737462 AGGGAGAAGGGATGGGGAAGAGG + Intronic
1080024260 11:27597228-27597250 AGGCAAAAGAGCTTGTGCAGGGG - Intergenic
1080388601 11:31824927-31824949 AGGGAGCGAACATTGGGCAGAGG + Intronic
1080468052 11:32516922-32516944 CGGGAGAAGAGGTTGGGGAGAGG - Intergenic
1080653881 11:34243435-34243457 AGGGTTAAGAGATTTGCCAGAGG - Intronic
1080795203 11:35557015-35557037 GGGGAGAAGAGAGAGGACAGAGG + Intergenic
1080995113 11:37589981-37590003 AGGGAGAAGTTAATAGGCAGAGG + Intergenic
1081489527 11:43556700-43556722 AGGGAGAAGAGAGAGGGTGGGGG - Intronic
1081531548 11:43963429-43963451 AGGGAGAAGAGATTGTGAGCTGG - Intergenic
1081553910 11:44139937-44139959 AGGCAGAAGGGATTGGGTGGTGG + Intronic
1081620897 11:44618732-44618754 ATGGAGAAGGGATGGGGGAGGGG - Intronic
1081624195 11:44637645-44637667 AATGAGAAGAGATTGGTCAATGG + Intergenic
1082565798 11:54676770-54676792 ATGGGGAAGAGAGTGGGGAGGGG - Intergenic
1082565909 11:54677387-54677409 AGGGACATGAGATTTGGGAGGGG + Intergenic
1082797377 11:57387882-57387904 GGGAAGAAGGGATGGGGCAGAGG + Intronic
1082814647 11:57499883-57499905 AGGGAGAAGGGGCTGCGCAGAGG + Intronic
1083236333 11:61353209-61353231 AGGGAGCAGAGATGGGGAGGAGG - Intronic
1083419790 11:62546318-62546340 AGGGAGAGGAGGTGGGACAGAGG + Intronic
1083433993 11:62630337-62630359 AGGGAGAGTTGATTGGCCAGCGG - Intronic
1083655523 11:64227330-64227352 CGGGAGGAAAGATTGGGCACAGG + Intronic
1083690310 11:64404390-64404412 AGGGAGAAGGTGTTGGGCTGAGG - Intergenic
1083779428 11:64910272-64910294 TGGGAGAAGAGCTGGGGCAGGGG + Intronic
1083891271 11:65596839-65596861 AGTGTGAAGAGAATGGACAGAGG + Intronic
1084603330 11:70159239-70159261 TGGGGGAAGAGATGGGCCAGGGG + Intronic
1084711989 11:70849352-70849374 AGGGAGAATAGATTGTGGATTGG - Intronic
1084721744 11:70910385-70910407 AGGGAGCAGAGGGTGGGAAGAGG + Intronic
1085049800 11:73374506-73374528 AGCGAGAAGTGTTTGGGCTGTGG + Intergenic
1085144235 11:74178495-74178517 AGGGAAGAGAGAGTGGGAAGTGG + Intronic
1085844309 11:80048324-80048346 AAGGAGAAGAGATGAGGCATGGG + Intergenic
1086065344 11:82737863-82737885 AGAGAGAACAGCCTGGGCAGAGG + Intergenic
1086229023 11:84546282-84546304 AGGAGGAAGAGAGAGGGCAGGGG - Intronic
1087102608 11:94380132-94380154 AGTTAGAAGAGGTTGGGAAGAGG - Exonic
1087442565 11:98205407-98205429 AGGCAAAAGAGCTTGTGCAGGGG + Intergenic
1088531892 11:110819478-110819500 AGGGAGTAGGGATTGGGAGGAGG + Intergenic
1088830730 11:113534198-113534220 AGGTAGAAGAGATAGAGGAGTGG - Intergenic
1088976827 11:114823184-114823206 ATGGAGAAGGGATTGGAGAGAGG - Intergenic
1089174111 11:116536126-116536148 TGGGAGAAGAGCTAGGGGAGGGG + Intergenic
1089260675 11:117221907-117221929 AGGGAGAAGAGAAAAGGGAGTGG - Intronic
1089457964 11:118636309-118636331 AGGGTGGTGAGATTGGGGAGGGG + Intronic
1089997533 11:122923032-122923054 GTGGAGCAGAGAGTGGGCAGAGG + Intronic
1090266105 11:125353900-125353922 AGGGAAAGGAGCTAGGGCAGGGG + Intronic
1090274747 11:125411513-125411535 AGGAGGAAGAGATGGGGAAGGGG - Intronic
1090621248 11:128562840-128562862 AGGGAGATGACTGTGGGCAGTGG - Intronic
1090650679 11:128803367-128803389 AGGGAGAGGAGAGAGGGCCGAGG - Intronic
1090975803 11:131679054-131679076 ATGGAGAAGAGAGTGGACAGGGG - Intronic
1090992007 11:131826217-131826239 AGGCAAATGAGATGGGGCAGAGG + Intronic
1091158462 11:133396796-133396818 AAGGAGGTGATATTGGGCAGAGG - Intronic
1091179339 11:133589306-133589328 AGGGAGAGGAGATAGGGCCGGGG + Intergenic
1091354083 11:134922269-134922291 AGGAAGAAGGGAGTGGGGAGAGG + Intergenic
1091375554 12:22661-22683 TGGGGGAAGAGGTTGGGCAGGGG + Intergenic
1091919800 12:4295033-4295055 AGGCAGAGGAGATGGTGCAGTGG - Intronic
1092207305 12:6622657-6622679 AGGGAGAATTGCTTGAGCAGAGG + Intronic
1093083139 12:14836844-14836866 AGAGGGAAGAGATAGGTCAGAGG - Intronic
1093139471 12:15491149-15491171 AGGGAAAAGAGACTGGACTGAGG - Intronic
1093194057 12:16109405-16109427 AGAGAGAAGAGATAAGGTAGTGG + Intergenic
1093904230 12:24671110-24671132 AGTGGGTAGAGAATGGGCAGGGG + Intergenic
1093957459 12:25237235-25237257 TGGGAGAAGGGATTGGGGAGTGG + Intronic
1094493830 12:30977318-30977340 AGGGAAAGGAGTGTGGGCAGGGG - Intronic
1094523732 12:31218541-31218563 TGGGTGAAGATGTTGGGCAGGGG + Intergenic
1094681255 12:32669240-32669262 AGGAAGAAGAGGCTGGGCACGGG + Intergenic
1095598102 12:43981860-43981882 GGGGAGGAGAGAATGGGGAGAGG + Intronic
1095637163 12:44448382-44448404 AGGGGGAAGAGATTGAGAGGGGG - Intergenic
1095956111 12:47807239-47807261 GGGGATAAGAGATAGGGCAGGGG - Intronic
1096344662 12:50834867-50834889 AGGGACATGAGATTTGGGAGGGG + Intergenic
1096745433 12:53723885-53723907 AGGGAGAAGAGTATGGCCTGTGG - Intronic
1096756235 12:53802309-53802331 AGATAGGAGAGGTTGGGCAGTGG + Intergenic
1097383808 12:58925414-58925436 AGGGAAAAGAGATAAGGCAAAGG + Intergenic
1097587249 12:61529798-61529820 AGGCAAAAGAGCTTGTGCAGGGG + Intergenic
1098173818 12:67771258-67771280 AGAGATAAGAGGTTGGGGAGTGG + Intergenic
1098282695 12:68877718-68877740 AGGAAAAGGAGCTTGGGCAGCGG + Intronic
1098364649 12:69689688-69689710 AGGGAGAAGAGAATTGACAGAGG - Intronic
1098466369 12:70791031-70791053 AGGGAGAACTGCTTTGGCAGTGG - Intronic
1098527652 12:71504654-71504676 AGGAAGCGGAGACTGGGCAGGGG - Exonic
1098617906 12:72553083-72553105 AGTGAGATGAGAGTGGGAAGTGG + Intronic
1098771726 12:74560779-74560801 AGGGAAAACAGAGTGTGCAGGGG + Intergenic
1098833371 12:75390924-75390946 AGGGAGGGGAGAGTGGGTAGGGG - Intronic
1099898853 12:88682280-88682302 AGGGACATGAGATTAGGGAGGGG + Intergenic
1100107633 12:91196183-91196205 AGTCAAAAGAGCTTGGGCAGGGG + Intergenic
1100306137 12:93351816-93351838 AGGGAGAAGAAAATGGGCCAGGG - Intergenic
1100697704 12:97113567-97113589 TGAGAGAAGGGGTTGGGCAGTGG + Intergenic
1101486868 12:105173415-105173437 AGGGAGGAGGGATGGGGGAGTGG + Intronic
1101608322 12:106267256-106267278 AGGGAGAAGAGCTTGAACAAAGG - Intronic
1101640753 12:106584389-106584411 AGGGTGATGAGTTTGGGGAGAGG + Intronic
1101909413 12:108850507-108850529 TGGGAGAGGAGCTTGGGGAGGGG + Intronic
1102227810 12:111241287-111241309 AGTGAGAAGTGTTTGGGCCGTGG - Intronic
1102340892 12:112120906-112120928 AGGGAGAAGATATTTGGGATCGG + Intergenic
1102403499 12:112651742-112651764 AGGGAGAAGAGAATGGAGATGGG - Intronic
1102794195 12:115674186-115674208 AGGAAGAAGAGAAGAGGCAGAGG - Intergenic
1103000491 12:117382052-117382074 ATAGAGAAGAGCTTGTGCAGAGG - Intronic
1103063233 12:117875745-117875767 ATTGAGAGGAGCTTGGGCAGAGG - Intronic
1103442838 12:120976418-120976440 TGGGAGAAGGGAATGGGGAGTGG - Intergenic
1103582661 12:121927040-121927062 AGGGAAATGAGATTGGGTGGGGG - Intronic
1103604381 12:122076366-122076388 TGGGAGGATAGCTTGGGCAGGGG + Intergenic
1103907828 12:124336302-124336324 AGGGAGCAGGGATGGGGCTGCGG - Intronic
1104997159 12:132665159-132665181 AGGGAGAAGGCTTTGGGCTGGGG - Intronic
1106310051 13:28546184-28546206 AGAGAGAAGAGCTTGTGCAAAGG + Intergenic
1106346556 13:28885304-28885326 AGGGAGGAGTGGCTGGGCAGGGG + Intronic
1106347239 13:28891115-28891137 TGGGAGAAGAGATTTGTCTGAGG + Intronic
1106391424 13:29338844-29338866 AGGCAGAAGTGGGTGGGCAGGGG + Intronic
1106828889 13:33556567-33556589 AAGGAAAAGACAGTGGGCAGTGG - Intergenic
1106843777 13:33714727-33714749 AGGGAGACAGGACTGGGCAGGGG + Intergenic
1107628782 13:42320494-42320516 AGGGGGAAGAGAGTGGGAGGAGG - Exonic
1107873273 13:44766124-44766146 TGTGAGATGAGATGGGGCAGAGG + Intergenic
1108327008 13:49343612-49343634 AGGGAGAAGAGAGAGGAGAGAGG + Intronic
1108708064 13:53007957-53007979 AGGGAGAACAGATGGGGAAGTGG + Intergenic
1108962743 13:56256380-56256402 AGGCAAAAGAGCTTGTGCAGAGG - Intergenic
1109646943 13:65271435-65271457 AGGCAAGAGAGCTTGGGCAGAGG + Intergenic
1110139613 13:72112412-72112434 AGGCAAAAGAGCTTGTGCAGGGG + Intergenic
1110433910 13:75458267-75458289 TTGGAGAAGAGATTGGCCAGGGG - Intronic
1110438526 13:75502403-75502425 AGGGAGGAGAGCTTGTGTAGGGG + Intergenic
1111241493 13:85481308-85481330 AGGGACATGAGATTTGGAAGAGG - Intergenic
1112225106 13:97532016-97532038 AGGGAGAAGACACGTGGCAGGGG + Intergenic
1112431782 13:99356354-99356376 AGGAAGAAGAGACGGGGCAGAGG + Intronic
1112668300 13:101602720-101602742 TGGGACAAGAGAATGGGGAGTGG - Intronic
1113255216 13:108498076-108498098 AGTGAGAAGAGATACGGCATTGG + Intergenic
1113649406 13:112025307-112025329 AAGCAAAAGAGATGGGGCAGGGG + Intergenic
1114297154 14:21340255-21340277 AGGGAGAAGAGCTTGCTCAAGGG + Intronic
1114351103 14:21852315-21852337 AGGAAGAAGAAACTGAGCAGTGG - Intergenic
1114355416 14:21902835-21902857 AGGAAGAAGAAACTGAGCAGTGG - Intergenic
1114362842 14:21994436-21994458 AGGGGACAGAGATTGGGCATGGG + Intergenic
1114486203 14:23063542-23063564 AGGGCCAGGAGAATGGGCAGAGG - Exonic
1114491139 14:23102782-23102804 AGGAAGAGCTGATTGGGCAGAGG - Intergenic
1114917923 14:27290047-27290069 AGGCAAGAGAGATTGTGCAGGGG + Intergenic
1115626244 14:35195505-35195527 AGGAAGAAGTGACTGGTCAGTGG - Intronic
1115634885 14:35281714-35281736 AGGGAGAAAAGATTCAGGAGAGG - Intronic
1115843496 14:37499531-37499553 AGTGAGAAGAGAATGGGCATTGG - Intronic
1116381431 14:44273896-44273918 AGGGAGCAGTGTTTGGGTAGGGG + Intergenic
1116533988 14:46007750-46007772 AGGAAGATGAGATTTGGGAGGGG + Intergenic
1117352732 14:54897273-54897295 AGTGAGTAGAGGTTGGGCACGGG - Intronic
1117507622 14:56418525-56418547 AAGGAGGCCAGATTGGGCAGTGG - Intergenic
1118017512 14:61675161-61675183 AGGAAGACAATATTGGGCAGAGG + Intergenic
1118088893 14:62450212-62450234 CGAGAGAAGAGATTTGTCAGAGG - Intergenic
1118331006 14:64816035-64816057 AGGGAGAACAGGTTGTGGAGAGG - Intronic
1118681025 14:68241783-68241805 AGGGAGACATGACTGGGCAGGGG - Intronic
1118869343 14:69728074-69728096 AGGCAGAAGAGATGGGCCAGGGG + Intronic
1119823303 14:77637169-77637191 AGGAGAAAGACATTGGGCAGAGG + Intergenic
1120719227 14:87872352-87872374 AGGCAAAAGAGCTTGTGCAGGGG + Intronic
1120722137 14:87900988-87901010 GGTGAGAGGAGAGTGGGCAGAGG - Intronic
1120996473 14:90421894-90421916 AGGGAGAAAGGCTGGGGCAGGGG - Intergenic
1121095949 14:91218095-91218117 AGGGAAGAGAGATGGGGGAGGGG + Intronic
1121138676 14:91521652-91521674 ATGGGGAAGGGATTGGTCAGAGG + Intergenic
1121188011 14:91994084-91994106 ATGGAGAAGTGTTTAGGCAGAGG - Intronic
1121401019 14:93677423-93677445 AGGCAAAAGAGCTTGTGCAGGGG + Intronic
1121435705 14:93917845-93917867 AGGGAAAAGTGATGGGGCAGGGG - Intergenic
1121469229 14:94139002-94139024 ATGGAGAGGAGAGGGGGCAGAGG - Intergenic
1121477368 14:94222829-94222851 AGAGAGAGAAGATTAGGCAGAGG - Intronic
1121657091 14:95605079-95605101 AGGGAGAAAAAAAGGGGCAGGGG - Intergenic
1121868031 14:97380815-97380837 CGGCAGCAGAGGTTGGGCAGAGG - Intergenic
1122254202 14:100464707-100464729 GGGGAGATGAGATGGGGTAGGGG - Intronic
1122254223 14:100464863-100464885 AAGGAGATGAGATGGGGTAGGGG - Intronic
1122254243 14:100464958-100464980 GGGGAGATGAGATGGGGTAGGGG - Intronic
1122555141 14:102574895-102574917 AGGGAGAACAGACTGGGAAAAGG - Intergenic
1122678380 14:103436260-103436282 AGGGAGAAAATATTCAGCAGTGG - Intronic
1123068156 14:105628413-105628435 AGGGAGGACAGAGTGAGCAGGGG - Intergenic
1123951737 15:25285296-25285318 AGGGAGAAAAGCATGGGAAGGGG - Intergenic
1123977990 15:25570705-25570727 AGGGAGAAGAGAATGAGGTGTGG + Intergenic
1124219848 15:27841269-27841291 ATGGAGAAGAGATTGGGGCAGGG + Intronic
1125353382 15:38790929-38790951 AGGAAGAAGAGATGGGGTGGGGG - Intergenic
1125421227 15:39506669-39506691 ATGGAGAGGAGATAGGGCAATGG + Intergenic
1125604532 15:40932455-40932477 AGGGTGAAGAGAGGGTGCAGAGG + Intronic
1125697518 15:41651713-41651735 GGGGAGAAGAGAAGGGGAAGGGG - Intronic
1125932884 15:43612674-43612696 AGGGGCAAGAGAGTAGGCAGTGG - Intronic
1125936817 15:43644294-43644316 AGGGAGGAGGGATTTTGCAGAGG - Intronic
1125945983 15:43712136-43712158 AGGGGCAAGAGAGTAGGCAGTGG - Intergenic
1126482241 15:49138206-49138228 GGGGGGAAGAGGGTGGGCAGGGG - Intronic
1126637873 15:50796724-50796746 AGGGTGAAGAGATTAGGAAGAGG + Intergenic
1126764967 15:52002546-52002568 AAGGAAATAAGATTGGGCAGAGG + Intronic
1127622462 15:60747113-60747135 TTAGAGAAGAGATTGAGCAGGGG - Intronic
1127698135 15:61471673-61471695 AGAGAGAAAAGATTGGGCCAGGG - Intergenic
1128501546 15:68230243-68230265 GGGGAGAAGAGTTCAGGCAGTGG + Intronic
1128704073 15:69825874-69825896 AGGGGGAAGTGGTGGGGCAGGGG - Intergenic
1128816616 15:70614457-70614479 AGGGAGAAGAGAATGAGCCCTGG - Intergenic
1128939530 15:71777153-71777175 AGTGGGAAGAGAAAGGGCAGTGG - Intronic
1129006072 15:72374927-72374949 AGGAAGAAGGGCTTGAGCAGAGG - Intronic
1129238189 15:74236358-74236380 ACGGTGGAGAGATGGGGCAGGGG - Exonic
1129668016 15:77590313-77590335 AGGGAGAGAAGAGTGAGCAGGGG + Intergenic
1130200937 15:81826277-81826299 AGGGAGAACAGAATGAGGAGAGG + Intergenic
1130314856 15:82786373-82786395 AGGGAGGAGAGAAGGGGGAGTGG + Intronic
1130448862 15:84030702-84030724 AGGGACATGAGATTTGGGAGGGG + Intronic
1130634933 15:85609251-85609273 GGGGAGAAGAGAATGGGGAGAGG - Intronic
1130642552 15:85692141-85692163 AGATAGAAGAAATTGGGGAGTGG - Intronic
1130782106 15:87051125-87051147 AAGGGGAAGAGGTGGGGCAGTGG + Intergenic
1131447537 15:92512530-92512552 AGAGATAAGAGATTGGGGTGTGG - Intergenic
1131665644 15:94568516-94568538 AGGAGGAAGAGGTGGGGCAGAGG + Intergenic
1131726718 15:95234609-95234631 AGGGACATGAGATTCGGGAGGGG - Intergenic
1132083929 15:98891283-98891305 ACGGAGATGAGACCGGGCAGGGG - Intronic
1132104255 15:99051384-99051406 AAGGTGCAGAAATTGGGCAGGGG - Intergenic
1132272373 15:100537760-100537782 AGGGACATGAGATTTGGGAGGGG - Intronic
1132284774 15:100654832-100654854 ATGGAGTAGAGATGGGGCGGGGG - Intergenic
1132301143 15:100776387-100776409 AAGGGGAAGACATCGGGCAGTGG + Intergenic
1132647265 16:1004863-1004885 AGGGAGAAGAGACGGGGGAGGGG + Intergenic
1132647273 16:1004881-1004903 AGGGGGTAGAGATGGGGGAGGGG + Intergenic
1132647282 16:1004908-1004930 AGGGAGCAGAGATGGGGGAGGGG + Intergenic
1132647302 16:1004971-1004993 AGGGTGTAGAGATGGGGGAGGGG + Intergenic
1132647311 16:1004998-1005020 AGGGAGAAGAGAAGGGGGAGGGG + Intergenic
1132647319 16:1005016-1005038 AGGGGGTAGAGATGGGGGAGGGG + Intergenic
1132647328 16:1005043-1005065 AGGGAGAAGAGAAGGGGAGGGGG + Intergenic
1132647335 16:1005060-1005082 AGGGGGTAGAGATGGGGGAGGGG + Intergenic
1132647344 16:1005087-1005109 AGGGAGCAGAGATGGGGGAGGGG + Intergenic
1132647363 16:1005132-1005154 AGGGAGCAGGGATGGGGGAGGGG + Intergenic
1132647372 16:1005159-1005181 AGGGAGAAGAGACGGGGGAGGGG + Intergenic
1132651724 16:1024235-1024257 AGGGAGCAAAGAAGGGGCAGCGG - Intergenic
1132727710 16:1345926-1345948 TGGGAGAGGAGATGGGGCAGGGG + Intronic
1132857404 16:2052855-2052877 AGGCAGCAGAGGTCGGGCAGGGG + Intronic
1133386947 16:5377413-5377435 AGGGAAAAGTGTTTGAGCAGAGG + Intergenic
1133417295 16:5616563-5616585 AGGGAGAAGGGAGAGGGAAGAGG - Intergenic
1133417307 16:5616601-5616623 AGAGAGAAGAGAGAGGGAAGAGG - Intergenic
1133699305 16:8294304-8294326 AAGGAGAGGAGACTTGGCAGGGG - Intergenic
1133747621 16:8699217-8699239 AGAGGGAAGAGATTGGGGAGGGG + Intronic
1133818021 16:9212974-9212996 GGGGTGCAGAGATGGGGCAGTGG + Intergenic
1133986359 16:10671787-10671809 AGGCAAAAGAGAATGTGCAGGGG + Intronic
1135090222 16:19508253-19508275 AGGGAGAAGTAATGGGGCAAGGG + Intronic
1135585761 16:23669715-23669737 AGTAATGAGAGATTGGGCAGAGG - Exonic
1135784050 16:25332067-25332089 AGGCAAAAGAGCTTGAGCAGGGG - Intergenic
1135904707 16:26500961-26500983 AGGGAGAAGAGAATGAGAAGGGG + Intergenic
1135915208 16:26599424-26599446 AGGGCGAAGTCATTGGACAGGGG + Intergenic
1136100959 16:27995638-27995660 AGGCAGAAGAGAATGGAGAGTGG + Intronic
1136381504 16:29898183-29898205 AGGGAGAAGGGAGAGGGGAGGGG - Intronic
1136505610 16:30700935-30700957 AGGCAGAAGAAATGTGGCAGGGG + Intronic
1136655200 16:31705485-31705507 TGGGGCCAGAGATTGGGCAGGGG + Intergenic
1137825124 16:51487550-51487572 GGGGAGAAGAGTTGGGGGAGGGG + Intergenic
1138212399 16:55174432-55174454 ATGGAGCAGAGATTGGGGAGGGG - Intergenic
1138391010 16:56669833-56669855 AGCGAGAAGAGAAGAGGCAGTGG - Exonic
1139369708 16:66459217-66459239 ATGGAGGACAGAATGGGCAGAGG - Intronic
1140628939 16:76828810-76828832 AGGGACAAGAGATTATGCACAGG + Intergenic
1140751072 16:78024400-78024422 AGAGAGAAGAGAGTGGGAGGAGG - Intronic
1140966165 16:79968121-79968143 AAGGAGAACAGATTGGGGAGGGG - Intergenic
1141267333 16:82508869-82508891 AAGGGGAAGAGATGGGGCAGGGG + Intergenic
1142141745 16:88475722-88475744 AGGCAGCAGACAGTGGGCAGTGG - Intronic
1142579605 17:933264-933286 TGGGAGAAGAGCTCGGCCAGAGG + Intronic
1142875994 17:2852699-2852721 AGGGAAAAGGAAGTGGGCAGGGG - Intronic
1142987383 17:3704349-3704371 AGAGAGACAAGAGTGGGCAGGGG + Intergenic
1143103711 17:4518101-4518123 AAGGAGAAGAGGCTGGACAGTGG + Intronic
1143781626 17:9232332-9232354 AGTGAGAAGAGATCGGGGACTGG - Intronic
1143784402 17:9245797-9245819 AGGCAGAGGGGAATGGGCAGGGG - Intergenic
1144014206 17:11178459-11178481 ATGGACAGGAGATTGGGCTGTGG - Intergenic
1144143972 17:12379055-12379077 AGGCAGAAGAGAATGTGCAAAGG - Intergenic
1144777229 17:17791062-17791084 AGGGAGAGGAGCTGGAGCAGAGG + Intronic
1145107809 17:20134467-20134489 AGGGAAAAAAAATTGGGCACAGG + Intronic
1146258859 17:31408787-31408809 AAGGAGAACAGCTGGGGCAGGGG + Intronic
1146381643 17:32333889-32333911 AGGGGGATGTGATTGGGAAGGGG - Intronic
1146545567 17:33735131-33735153 AGGGTGAAGAGTTTGGGCACGGG - Intronic
1146726600 17:35161481-35161503 CGGGAGATGAGATTGGAGAGGGG + Intronic
1146805669 17:35863314-35863336 AGGGAAAAGAGATTAGAAAGAGG - Intronic
1146910498 17:36645545-36645567 AGGGAGGAGAGAGTGGGAGGAGG - Intergenic
1147266957 17:39240183-39240205 AGGAAGGTGAGTTTGGGCAGGGG + Intergenic
1147281527 17:39365347-39365369 AGGGACAAGATGTTGGGCGGAGG - Intronic
1147673529 17:42190333-42190355 GGGAAGAACAGATAGGGCAGAGG - Intronic
1147869604 17:43578161-43578183 AGGCAGAGGAGAGAGGGCAGAGG + Intronic
1148085165 17:44989568-44989590 AGGGAAACGAGAGTGGGCAAAGG - Intergenic
1148244327 17:46020666-46020688 AGAGAAAAGAGCTTGTGCAGGGG + Intronic
1149029406 17:52066540-52066562 AGGCAAAAGAGCTTGTGCAGAGG - Intronic
1149336107 17:55637823-55637845 AAGGAGAAGAGATTTGCCTGGGG + Intergenic
1149506210 17:57195993-57196015 AGTGAGAATAGATTAAGCAGAGG + Intergenic
1149971955 17:61227628-61227650 AGGAAGAATAAATTGGGCATAGG + Intronic
1150224998 17:63519690-63519712 AGGAAGCAGGCATTGGGCAGTGG - Intronic
1150232595 17:63565236-63565258 ATGGTGAAGAGTTTGGGTAGTGG + Intronic
1151123331 17:71817663-71817685 AGGGAGAAGAGAGGGAGAAGAGG - Intergenic
1151138685 17:71971515-71971537 AGGGAGCAGAGGATGGGGAGGGG + Intergenic
1151272324 17:73006463-73006485 AGGGAGAAGAGGATGGGGAGGGG + Intronic
1151447821 17:74178668-74178690 ATGGACAGGAGGTTGGGCAGTGG - Intergenic
1151519369 17:74617290-74617312 AGGGAGAAGAGAAGGTGGAGAGG - Exonic
1151672752 17:75580794-75580816 AGGGACAGGAGATTGGACAGGGG + Intergenic
1151746206 17:76013291-76013313 AGGGAGGTGACATTGGGAAGGGG - Intronic
1151848542 17:76675229-76675251 AGGGAGAAGAAAGTGGGCAATGG + Exonic
1152228848 17:79104786-79104808 ATGGGGAGGAGGTTGGGCAGGGG + Intronic
1152247344 17:79191931-79191953 GGTGAGCAGAGATGGGGCAGTGG + Intronic
1152372808 17:79901117-79901139 AAGAAAAAAAGATTGGGCAGAGG + Intergenic
1153002347 18:466910-466932 GGAGAGAAGAGATAGGGGAGGGG - Intronic
1154388624 18:13917627-13917649 AGGAAGAAGAGACAGGGCCGGGG + Intergenic
1154484818 18:14865239-14865261 AGGGAAAAGAGGGTGGCCAGTGG - Intergenic
1155072827 18:22331123-22331145 GAGGAGAAGAGATTGGGAAATGG + Intergenic
1155516110 18:26625263-26625285 AAGGACATGAGATTTGGCAGGGG + Intronic
1156271822 18:35542313-35542335 AGGGAGAAGACATTAAGGAGAGG - Intergenic
1156457496 18:37302950-37302972 TGGGAGAGGAGAGTGGGAAGGGG + Intronic
1157396056 18:47342479-47342501 ATGGAGAAAAGATGGGGCGGGGG + Intergenic
1157546033 18:48547105-48547127 AGAGAGAAGAGAAAGGGCAGAGG + Intronic
1157563790 18:48666193-48666215 AGGGAGACAAGAGTGAGCAGGGG - Intronic
1158058710 18:53312953-53312975 AGGGAGGAGGGAGTGGGGAGAGG + Intronic
1158202683 18:54958283-54958305 GTGGGGAAGAGAGTGGGCAGCGG + Intronic
1158353731 18:56593214-56593236 AGGGAAGAGAGAGTGGGCAAAGG + Intergenic
1158583839 18:58710919-58710941 AGGAAGAACAGATGAGGCAGTGG + Exonic
1158686623 18:59620694-59620716 AGGCAGGAGAGCTTGTGCAGGGG - Intronic
1158851040 18:61496046-61496068 AGGGAGGAGAGAGGGGGGAGAGG - Intronic
1158851049 18:61496070-61496092 AGGGAGGAGAGAGGGGGGAGAGG - Intronic
1159061006 18:63513895-63513917 CAGGAGAAGAGAGTGGGCTGAGG + Intergenic
1159643413 18:70889173-70889195 AGGGACATGAGATTTGGGAGGGG + Intergenic
1160128403 18:76201879-76201901 AGGCAGCACAGATTTGGCAGAGG + Intergenic
1160657598 19:281550-281572 AGGGTGGTGAGAATGGGCAGGGG + Intronic
1160872112 19:1282323-1282345 AGGGGGAAGAGAGTGGGAAGGGG + Intergenic
1161957947 19:7506684-7506706 AGGGGGAGGAGCTTGGGAAGAGG - Intronic
1162207119 19:9064501-9064523 AGAGAGAAGAGATTGGGAACTGG + Intergenic
1162938259 19:13992785-13992807 TGGAAGAAGGGTTTGGGCAGTGG - Intronic
1162967600 19:14163433-14163455 AGGTAGGAGAGAAGGGGCAGAGG + Intronic
1163013573 19:14440423-14440445 AAGGAGAGGAGATGGGGCACTGG + Intronic
1163424979 19:17236146-17236168 AGGGACAGGAGATGGGGGAGGGG + Intronic
1163455638 19:17404341-17404363 AGGGAGAAGGGAGAGGGCCGGGG - Intronic
1163478944 19:17543186-17543208 AGGAGGAGGAGGTTGGGCAGAGG + Intronic
1163818002 19:19479039-19479061 ATGGAGAAGAGGTTGGAGAGTGG + Intronic
1163822003 19:19501319-19501341 AGGAACAGGAGATTGAGCAGCGG + Exonic
1163847585 19:19646298-19646320 AGGTTGAAGATGTTGGGCAGGGG + Exonic
1164441423 19:28283052-28283074 GGGGAGAAGAGTTTAGGGAGAGG - Intergenic
1164596017 19:29530982-29531004 TGGGAGAAGGGATTGGGGATGGG + Intronic
1164721229 19:30433074-30433096 ACAGAGAGGAGATAGGGCAGAGG - Intronic
1165058139 19:33191871-33191893 AGGGAGCAGTGGTGGGGCAGAGG - Intronic
1165070366 19:33251865-33251887 AGGCTGCAGAGATTAGGCAGTGG + Intergenic
1165450404 19:35879047-35879069 AGGGAGAGGAGATGGGGCAGAGG - Intronic
1165767891 19:38362169-38362191 ACCGTGAAGGGATTGGGCAGCGG - Intronic
1165936136 19:39390193-39390215 TGGGAGCAGAGGTGGGGCAGCGG - Intronic
1166326858 19:42056404-42056426 AGGGGGAAGAGGGTGTGCAGAGG + Intronic
1167127445 19:47559915-47559937 AGGGAGTAGGGATGGGGCAGGGG - Intergenic
1167250366 19:48395876-48395898 AGGGAGAGGAGGCTGGGCACTGG + Intronic
1167425500 19:49427826-49427848 AGGGAGAAGGGTTTGGGAACAGG + Intronic
1167485876 19:49762756-49762778 AGGGAGGAGAAAGTAGGCAGCGG - Intronic
1167733465 19:51276247-51276269 ATGGAGAAGAGATATGGCAGTGG + Intergenic
1167766389 19:51485507-51485529 AGGGAGAAGAGATTGGGCAGTGG + Intronic
1167881122 19:52458139-52458161 TGGAAGAAGAGATTAGGAAGAGG + Intronic
1168323689 19:55526044-55526066 TGGGAGTGGAGACTGGGCAGGGG - Intergenic
925094436 2:1184825-1184847 AAGGACATGAGATTTGGCAGGGG - Intronic
925711604 2:6746534-6746556 TGGGAGAGAAGAATGGGCAGAGG + Intergenic
925751038 2:7090720-7090742 AGGGAGAAATGAGAGGGCAGGGG + Intergenic
926067765 2:9857959-9857981 AAGGACATGAGATTTGGCAGGGG - Intronic
926104902 2:10143966-10143988 AAGGGGAAGAAAGTGGGCAGAGG - Intronic
926562862 2:14436477-14436499 AGGGAGAAGGGAGAGGGGAGAGG + Intergenic
926638322 2:15207501-15207523 AGGGATAAGAGATTTGGGAGAGG + Intronic
926647463 2:15305083-15305105 AGGGATATGAGATTTGGGAGAGG + Intronic
927121413 2:19967408-19967430 AGAGAGAGGAAATTTGGCAGGGG - Intronic
927130809 2:20057954-20057976 AGGGAGAGGAGGATGGGGAGAGG + Intergenic
928116516 2:28548930-28548952 AGGTAGGAGGGACTGGGCAGAGG + Exonic
928177849 2:29047091-29047113 AGGCGCAAGAGATGGGGCAGGGG - Intronic
928202977 2:29262909-29262931 AGGGAGAAGAGAAAGGTCACAGG + Intronic
928203549 2:29267555-29267577 AGGGAGGAGAGAGAGGGCACAGG - Intronic
928838707 2:35579372-35579394 AAGGAGGCAAGATTGGGCAGAGG + Intergenic
928928375 2:36600151-36600173 AGAGATAAGAGATTGGGGTGTGG - Intronic
929187858 2:39113856-39113878 AGGGAAAAGAGATAGTGCTGAGG - Intronic
929508797 2:42550627-42550649 TGGGACAAGAGACTGGGAAGGGG + Intronic
929844289 2:45505878-45505900 TGGGAGGAGGGATTAGGCAGAGG - Intronic
929854961 2:45629147-45629169 AGGGAGTAGAGATTGGTGAGTGG + Intergenic
929918104 2:46153017-46153039 AGGGAGGAGAGTAAGGGCAGAGG - Intronic
930412705 2:51047070-51047092 GGGGAGAAGAGAATGGGGAGAGG - Intergenic
930864095 2:56105881-56105903 AGGAAGAAGAGAGAGAGCAGGGG + Intergenic
931026565 2:58117988-58118010 AGAGATAAGAGGTTGGGGAGCGG + Intronic
931184303 2:59934872-59934894 AGGAAGAAGAGAAAGCGCAGAGG + Intergenic
931674706 2:64682796-64682818 AGGGAGAATAGTTTGGTGAGAGG - Intronic
932260577 2:70323486-70323508 ATGGAGAAGGGGTTGGGGAGAGG + Intergenic
932266128 2:70368323-70368345 AGGGAGAAGAGACTCAGCACTGG - Intergenic
932474504 2:71993520-71993542 AGAGAGAAGGAATTGGTCAGAGG + Intergenic
932507411 2:72249034-72249056 TGGGAGGAGTGATTGAGCAGAGG + Intronic
932621292 2:73266053-73266075 ATGGAGAGGAGATGGGGGAGAGG + Intronic
933101418 2:78263276-78263298 AAAAAGAAGAGAATGGGCAGTGG + Intergenic
933813054 2:86045002-86045024 TGGGAGAAGGTCTTGGGCAGTGG - Intronic
933879098 2:86650453-86650475 GGGGAGGGGAGAATGGGCAGTGG + Intronic
934493119 2:94775747-94775769 AAGGACATGAGATTGGGGAGGGG - Intergenic
934544276 2:95201697-95201719 AGGGGGAAGAGATTTGGCAGTGG + Intergenic
934562625 2:95320954-95320976 AGGGAGGAGAGGCTGGGGAGGGG - Intronic
934604901 2:95687187-95687209 TGGGAGAAGAGGCTGGGAAGAGG - Intergenic
934773180 2:96921046-96921068 GGGGATTAGAAATTGGGCAGGGG + Intronic
935305615 2:101733544-101733566 AAGGAGAAGAGAAGAGGCAGGGG + Intronic
935363890 2:102269811-102269833 AGGTAGAGGAGATTTGGCATAGG - Intergenic
935666256 2:105515772-105515794 ACGGAGAAGAGTTTGGGGACAGG - Intergenic
935897643 2:107754948-107754970 AGGCAGTAGTGATTGGGCATTGG + Intergenic
936250703 2:110866277-110866299 CGGGAGAAGATCTGGGGCAGTGG + Intronic
936470741 2:112796712-112796734 AGGAAGAATAGATTGAGCAAAGG - Intergenic
936538351 2:113329727-113329749 TGGGAGAAGAGGCTGGGAAGAGG - Intergenic
936559657 2:113526161-113526183 AGGGAGAATACATAGGGGAGGGG + Intergenic
937311097 2:120903954-120903976 AGGAAGGGGAGATTGGGGAGGGG + Intronic
937336790 2:121067175-121067197 GTGGAGAAGAGATGGGGCAGAGG + Intergenic
937935394 2:127239757-127239779 AGGGACATGAGATTTGGGAGGGG + Intergenic
938137166 2:128769049-128769071 AGGAAGAAGAGAAGGGGGAGGGG + Intergenic
938204152 2:129402878-129402900 AGGGAATAGAGAATGGGTAGTGG + Intergenic
939008846 2:136821463-136821485 AGGGAGGAGAGAGAGGGAAGGGG - Intronic
939035025 2:137120510-137120532 AGGGAGAGGGGATGGGGAAGGGG + Intronic
939686544 2:145207442-145207464 AGGGAGAAGAGTTAGTGCAAAGG - Intergenic
939846375 2:147251358-147251380 AGGGAGAAGCAAATGGGTAGAGG + Intergenic
940372954 2:152922934-152922956 AAGAAGAAGAGAAGGGGCAGGGG - Intergenic
940527340 2:154833451-154833473 CTGGAGTAGAGATTGGGCTGGGG - Intronic
941038219 2:160590575-160590597 AGGGAGAGGAGAAGGGGAAGGGG - Intergenic
941104157 2:161333488-161333510 AGGCAGTATATATTGGGCAGTGG + Intronic
941220395 2:162772073-162772095 AGGTAGAACAGATTCAGCAGTGG - Intronic
941349371 2:164413622-164413644 AGGGACATGAGATTTGGAAGGGG - Intergenic
941362709 2:164572273-164572295 TGGGAGAAGAGATTTGAAAGGGG - Intronic
941499941 2:166261540-166261562 AGGGAGAAGAGATGGAGCCTAGG + Intronic
941809239 2:169739002-169739024 AGGGAGAGGAGATGGGGGAGGGG - Intronic
942174879 2:173323633-173323655 AGAGAAAAAAGATTGGGAAGTGG - Intergenic
942769708 2:179502315-179502337 AAGGAGATGAGATTTGGCAGAGG + Intronic
944771570 2:202919482-202919504 AGGTAGAACAGATTGAGAAGTGG - Intronic
944942965 2:204651101-204651123 AAGGACATGAGATTTGGCAGGGG - Intronic
945014713 2:205503019-205503041 AGAGAGAAGAGAGAGGGGAGAGG - Intronic
945034331 2:205691303-205691325 TGGGAGAGGAGAAAGGGCAGAGG + Intronic
945180722 2:207088408-207088430 AGGGAGGAGAGATGGGGAAGTGG - Intronic
945357971 2:208861085-208861107 AGGGACATGAGATTGGGGAGGGG + Intergenic
945556166 2:211279129-211279151 AAGGAGAAGTGCTTGGGCAAAGG + Intergenic
945772227 2:214058354-214058376 AGGGAAGAGAGATGGGGGAGTGG + Intronic
946437343 2:219666065-219666087 AGGGAGAAGAAAATGGAAAGAGG - Intergenic
946450269 2:219773665-219773687 ATAGAGGAGAGATTGGGGAGAGG - Intergenic
946656352 2:221952177-221952199 AGGCAGGAGAGCTTGTGCAGGGG + Intergenic
946683456 2:222242391-222242413 AGGGAACAGGGATTGGGCGGAGG - Intronic
947003470 2:225485205-225485227 AGGCAAAAGAGCTTGTGCAGGGG - Intronic
947060880 2:226163710-226163732 AGAGAGGAGAGATTGGGAGGGGG - Intergenic
947689845 2:232125074-232125096 AGGGAGAAGAGAGCGTGCAAAGG - Intronic
948008991 2:234635728-234635750 AGGGAAGAGAGGTTGTGCAGGGG - Intergenic
948040656 2:234899029-234899051 AGGGAGAACAGAGTGGGAACAGG - Intergenic
948180285 2:235973892-235973914 AGGGAAAAGCGCCTGGGCAGTGG + Intronic
948484241 2:238270581-238270603 AGGGAGGAGAGCTGGGGCACAGG + Intronic
948597296 2:239088172-239088194 ACGCAGAAGTGATGGGGCAGAGG - Intronic
948856328 2:240732173-240732195 AGGGAGGAGAGAATGAGCGGTGG + Intronic
1168829244 20:835634-835656 AGGGAGAAGGGAGTAGGCTGTGG - Intronic
1169005498 20:2203953-2203975 TGGGAGAATGGATTGGGCGGCGG - Intergenic
1169027496 20:2383078-2383100 AGGAAAGAGAGATGGGGCAGTGG + Intronic
1169100721 20:2946213-2946235 AGGGAGGGGAGGTTGCGCAGTGG + Intronic
1169135759 20:3196086-3196108 TGGGAGAAGAGATTCGGGTGGGG - Intronic
1169724746 20:8716537-8716559 AGAGAGAAGAGTGTGGGAAGAGG - Intronic
1170505443 20:17021014-17021036 AGGCAGAAGAGGTTGGGTAGAGG - Intergenic
1170585198 20:17729222-17729244 AGGGATCAGGGATGGGGCAGCGG - Intronic
1170714345 20:18818968-18818990 AAGGAGCAAGGATTGGGCAGGGG + Intronic
1170911453 20:20574285-20574307 AGGGAGAAGAGCTAGAGCAAAGG + Intronic
1170937173 20:20820520-20820542 AGGAATAAGAGAATGGGAAGAGG - Intergenic
1171159215 20:22906428-22906450 AGGCAGAAGAGATTGGACAGTGG + Intergenic
1171388650 20:24786943-24786965 GGGGAGAAGAGGCTGGGCGGGGG - Intergenic
1172094802 20:32455452-32455474 AGGGAGAAGAGCCTGTCCAGAGG + Intronic
1172100567 20:32482535-32482557 AGGGAGGAGAGAGAGGGCGGAGG + Intronic
1172173406 20:32958343-32958365 AGGGAGAGGATAAGGGGCAGAGG + Intronic
1172813652 20:37669695-37669717 TGGCAGCAGAGATTGGGAAGGGG + Intergenic
1173001919 20:39110969-39110991 AGGCTGAAATGATTGGGCAGAGG - Intergenic
1173327571 20:42047868-42047890 AGGAAGATGATATTGGGCACTGG - Intergenic
1173741346 20:45404883-45404905 AGGGAGAAGGGCATGTGCAGAGG - Intronic
1173950061 20:46985218-46985240 AGGGAGGAAAGAAGGGGCAGAGG - Intronic
1174242033 20:49144587-49144609 AAGGAGAAGAGAATTGACAGAGG - Intronic
1174340374 20:49891541-49891563 AGGGGGATGGGATGGGGCAGGGG - Exonic
1175466327 20:59192955-59192977 AGGGAGGTGGGAATGGGCAGTGG + Exonic
1175569921 20:60010705-60010727 AGGCAGGAGAGGTTGGGGAGAGG + Intronic
1176796509 21:13374236-13374258 AGGGAAAAGAGGGTGGCCAGTGG + Intergenic
1177053982 21:16276432-16276454 AGAGAGAAAAGATTGAGCAAAGG + Intergenic
1177296051 21:19177128-19177150 AGGGAAATGAGATTGGGAAAAGG + Intergenic
1177628877 21:23701089-23701111 AGGAAGATGAGATTTGGGAGGGG + Intergenic
1177976215 21:27854332-27854354 AGGAAAAAGAGCTTGTGCAGGGG - Intergenic
1178135239 21:29619476-29619498 AGGGGGAAAAGAGTGGGAAGGGG + Intronic
1178328125 21:31661683-31661705 AGGGAGAAGGGATTCCTCAGAGG - Intronic
1178476890 21:32944874-32944896 AGTGAGAAGAGGGTGGGCAAGGG + Intergenic
1179108982 21:38429008-38429030 AGGGAGAAAAGATTGCACACTGG - Intronic
1179450603 21:41465947-41465969 AGGGAGAGCAGGCTGGGCAGGGG + Exonic
1179453548 21:41482234-41482256 GGAGAGAAGAGATTGGGAATAGG - Intronic
1179530494 21:42015342-42015364 AAAGAGAAGAGAATGGGAAGTGG + Intergenic
1179537206 21:42060364-42060386 AGGGTGGAGTGATAGGGCAGTGG + Intergenic
1179557925 21:42192459-42192481 AGGGAGAAGGGTTTGGGAATAGG - Intergenic
1179586684 21:42377905-42377927 AGCGAGAAGAAAATCGGCAGCGG + Intronic
1180938577 22:19641954-19641976 AAGGAGAAGAGGTGGGGGAGGGG + Intergenic
1181343472 22:22200669-22200691 TGAGACAGGAGATTGGGCAGGGG - Intergenic
1181406725 22:22690216-22690238 AGTGAGAAGTGAGTGGACAGGGG + Intergenic
1182352536 22:29706876-29706898 AGGGAGAGGAGGATGTGCAGAGG - Intergenic
1182548598 22:31089494-31089516 AGTGCCAAGAGATTGGGAAGTGG + Intronic
1182695417 22:32195907-32195929 AGGGAGGGGAGCTTGGGGAGAGG - Intronic
1182759773 22:32712989-32713011 ATGGGGAAGAGAATGGGGAGAGG - Intronic
1183096910 22:35557744-35557766 AGGGAGAAGAGGCTGAGAAGGGG + Intergenic
1183245579 22:36690930-36690952 TGAGGGATGAGATTGGGCAGAGG - Intronic
1183579045 22:38712276-38712298 AGGGAATAGTGAATGGGCAGAGG + Intronic
1183601097 22:38841084-38841106 AGAGGGGAGAGATTGGACAGTGG + Intronic
1183996972 22:41641588-41641610 AGGGGGTAGTGATGGGGCAGTGG - Intronic
1184225768 22:43128160-43128182 TGGGGGAATAGAGTGGGCAGTGG + Intronic
1184713103 22:46264566-46264588 GAGGAGATGAGATTTGGCAGGGG - Intergenic
1184938294 22:47740777-47740799 AGAAAGTAGAGACTGGGCAGGGG - Intergenic
1184982198 22:48102666-48102688 TGGGAGAAGTGGGTGGGCAGAGG - Intergenic
1185001966 22:48251727-48251749 AGGGAGAACAGAGTAGGTAGGGG - Intergenic
1185182015 22:49369107-49369129 ACGGAGGAGAGAGTGGGCAGCGG - Intergenic
1185226634 22:49657214-49657236 AGCGGGCAGAGATGGGGCAGAGG - Exonic
949104489 3:187610-187632 AGAGAGAAAAGATTGGGGATGGG - Intergenic
949476004 3:4446334-4446356 AGGGAAGAGAGTTTGTGCAGGGG - Intronic
949879731 3:8651927-8651949 AGGGAGGAGAGATTGGCAGGAGG - Intronic
950108820 3:10405519-10405541 AGGGAGAAGAGAATAGGAAGGGG + Intronic
950160071 3:10753839-10753861 AGGGAGAAGAGAAGGAGAAGAGG + Intergenic
950542215 3:13619406-13619428 AGGAAGAAGAGAAAGGGAAGGGG - Intronic
950869603 3:16217340-16217362 AGTGAGAAGAGCTTTAGCAGAGG + Intronic
950915596 3:16641867-16641889 AGGGAGAAGTGAAGGGGCAAGGG - Intronic
951692180 3:25408026-25408048 AGGAAGAAGTGATAGGTCAGTGG - Intronic
951704098 3:25526434-25526456 GTGGAGAATAGATTGGGCAAGGG + Intronic
952051542 3:29390217-29390239 AGGCAGAAGAGATGGGGAAAGGG - Intronic
952254804 3:31685838-31685860 AGGGAGAAGAGATGCTGCTGTGG + Intronic
952553972 3:34511010-34511032 AGGGAGAAGACAAGGGGAAGAGG - Intergenic
952687573 3:36167746-36167768 AGGGAGAAGAGAGTGAGAGGAGG - Intergenic
952839357 3:37631013-37631035 GGGGAGAAGAGGTTGGCCTGGGG + Intronic
952881715 3:37989984-37990006 AGGGAGAGGGTCTTGGGCAGTGG + Intronic
953086335 3:39671675-39671697 AGGGAGAACAGATAAGGGAGGGG - Intergenic
953468020 3:43141498-43141520 AGGGAGGCAAAATTGGGCAGAGG - Intergenic
953498298 3:43407792-43407814 AGGGTGAAGAGAATGTGCAAAGG + Intronic
954510615 3:51121516-51121538 AGTGAGGAGAGATTGCTCAGTGG + Intronic
954711225 3:52506006-52506028 ATGGAGAAGAGATGGGGCCTTGG - Intronic
954712447 3:52511912-52511934 AGAGAGACGAGGCTGGGCAGGGG - Intronic
954788739 3:53114853-53114875 AGTCAGAAGAGTTTGGGAAGTGG - Intronic
954969439 3:54639074-54639096 AGAGATAAGAGATTGGGGCGTGG + Intronic
955323008 3:57987866-57987888 AGGCAGAAGAGCTAGGGCAGAGG + Intergenic
955395337 3:58553334-58553356 AAGGACAAGAGATTTGGGAGGGG - Intergenic
955439945 3:58944704-58944726 AGGGAGAAGTGAAAGGGGAGTGG - Intronic
955574350 3:60343282-60343304 TGGGGGAAGAGACAGGGCAGAGG + Intronic
955792467 3:62602794-62602816 AGGGAGAAGAGATCAAGCTGAGG - Intronic
955953338 3:64263876-64263898 AGGGAGACCACATGGGGCAGAGG - Intronic
956682159 3:71790922-71790944 ATAGAGAAGAGATTGGAGAGTGG + Intergenic
956893664 3:73638141-73638163 AGGGACAAGAGTTGGAGCAGAGG - Intergenic
957590839 3:82195791-82195813 TGGGAGTAGTGATTGGGTAGAGG + Intergenic
957813239 3:85255687-85255709 AGGCAGTAGAGATGGGGCAAAGG - Intronic
958560393 3:95742090-95742112 AAGGAGATGAGATTTGGGAGGGG - Intergenic
958996824 3:100915133-100915155 AGGGGGAAGAGAGTGGGCTGAGG - Intronic
959335604 3:105060838-105060860 GGGGAGAGGAGATTAGGAAGAGG + Intergenic
959336441 3:105071454-105071476 AGGGAGAAAAGATAGGGAAAAGG + Intergenic
959785586 3:110294208-110294230 AGGGACATGAGATTTGGCAGGGG - Intergenic
960337646 3:116437573-116437595 AGGGAGAAGAGAGAGGGAAAAGG + Intronic
960691950 3:120355695-120355717 AGGGAAGGGAGAATGGGCAGTGG + Intergenic
961060458 3:123824040-123824062 GGGATGAAGAGATTGGGTAGAGG - Intronic
961331611 3:126145671-126145693 AGGGAGAAGGAAATGGGGAGTGG + Intronic
961866656 3:129958367-129958389 AGGGAGAGGAGACTGGACTGTGG + Intergenic
962194070 3:133342768-133342790 AGGGAGAAGAGAATAGGGAGAGG + Intronic
962194560 3:133350285-133350307 AGGAAGGAGAGAATGGGGAGAGG + Intronic
962336994 3:134542707-134542729 GTGGAGAAGAAATTGGGGAGTGG - Intronic
962406336 3:135103779-135103801 AGGGAGAGAAGCTTGGGGAGTGG - Intronic
963177197 3:142312218-142312240 AGGGAGTCGAGATTGTGCATGGG + Intronic
963600125 3:147371701-147371723 AAGGAGAAGAGGTTGGGTGGTGG + Intergenic
964090738 3:152873413-152873435 AGGGACATGAGATTTGGGAGGGG - Intergenic
964313599 3:155420004-155420026 AGGCAAAAGAGCTTGTGCAGGGG - Intronic
964385735 3:156145571-156145593 AGGAAAAAGAGGGTGGGCAGGGG + Intronic
964394317 3:156229307-156229329 AGGAGGAAGAGAGTGGGGAGAGG + Intronic
964427926 3:156572805-156572827 AGGGAGGAGAGCATGTGCAGGGG + Intergenic
964722687 3:159782991-159783013 AGGGAGACAAGGTTGGGAAGGGG + Intronic
964966074 3:162495445-162495467 AGGGACATGAGATTTGGAAGGGG - Intergenic
965065609 3:163843656-163843678 AGGGAAATAAGATTAGGCAGGGG - Intergenic
965092436 3:164180593-164180615 AAGGACATGAGATTTGGCAGGGG - Intergenic
965281776 3:166764261-166764283 AGGGACATGAGATTTGGGAGGGG - Intergenic
966042304 3:175507007-175507029 TGGGAGAAGAGGATGTGCAGAGG - Intronic
966088282 3:176098281-176098303 AGGGACACGAGATTTGGGAGGGG - Intergenic
967350632 3:188510560-188510582 ACGAAGGAGAGAGTGGGCAGGGG - Intronic
967935714 3:194725883-194725905 AGAGAGATGGGATTGAGCAGAGG + Intergenic
968059005 3:195713630-195713652 AGGGAGGAGACTTAGGGCAGGGG - Intergenic
968424209 4:510830-510852 AGGGAGAGAAGACTGGGCTGGGG - Intronic
968726584 4:2250704-2250726 AGGGAGAATAGAGTGGGGATGGG + Intronic
968880229 4:3294815-3294837 AGGGAGGAGCGACAGGGCAGTGG + Intronic
969077877 4:4594661-4594683 TGGGAGGAGAGCCTGGGCAGGGG - Intergenic
969086756 4:4662368-4662390 AGTGAGAAGAAAAGGGGCAGAGG - Intergenic
969108844 4:4828774-4828796 AGGGAAAAGAGAGAAGGCAGAGG - Intergenic
969278242 4:6151450-6151472 AGAGAGAACAGCTTGGGCAGAGG - Intronic
969534154 4:7745803-7745825 AGTGAGAGGTGATTTGGCAGGGG - Intergenic
970204031 4:13638221-13638243 AGGGAGAAGAGCTTGTGCTGAGG + Intergenic
970217493 4:13775538-13775560 AGGCAAAAGAGTTTGTGCAGGGG + Intergenic
970375287 4:15451060-15451082 AGGTAGAAGAGGGTGGTCAGGGG - Intergenic
970721702 4:18996407-18996429 AGGCAGGAGAACTTGGGCAGGGG + Intergenic
970998798 4:22299076-22299098 AGAGGGAAGAGCATGGGCAGAGG - Intergenic
971122044 4:23715423-23715445 AGGGAGAAGAAATTGGGACCTGG - Intergenic
972175682 4:36402632-36402654 AGGGAACAGAGCTTGTGCAGGGG - Intergenic
972353591 4:38260036-38260058 AGGGAGAGGCTCTTGGGCAGAGG - Intergenic
972735491 4:41836979-41837001 AGGCAAAAGAGCTTGTGCAGGGG - Intergenic
972792579 4:42387265-42387287 AGAGAAAAGAGCTTGTGCAGGGG + Intergenic
973779516 4:54275203-54275225 AGGGAGAAGAGAATATGAAGAGG + Intronic
974709417 4:65571010-65571032 AAGAAGGAGAGAGTGGGCAGCGG - Intronic
974875340 4:67697556-67697578 AGGAAGAATAGATTAAGCAGGGG - Intronic
974919050 4:68214399-68214421 AGTGAGAAGAGATAGTGGAGGGG - Intergenic
975901957 4:79164040-79164062 AGGGAGGTGAGGTTGGGGAGAGG - Intergenic
976911488 4:90312486-90312508 AGGCAGATGAGAGTAGGCAGAGG + Intronic
976953620 4:90866190-90866212 AAGGAGAAGAGAGAGGGCTGAGG - Intronic
977031195 4:91886103-91886125 ATGGAGAAAAGATTGGCCACTGG - Intergenic
977099633 4:92794308-92794330 AGGCAGAAGAGAGTGGCCAGTGG - Intronic
978431501 4:108637400-108637422 AGGGAGAAGGAATAGGGGAGGGG + Intergenic
978553218 4:109950231-109950253 AGGGAGAGGAGCTGGGGAAGAGG - Intronic
978896394 4:113893369-113893391 AGGGAGAGGTGAATAGGCAGAGG + Intergenic
979038251 4:115753534-115753556 AGGCAGGAGAGCTTGTGCAGGGG - Intergenic
980062480 4:128146638-128146660 AGGGGAATGGGATTGGGCAGGGG + Intronic
980065862 4:128187676-128187698 AAGGACATGAGATTTGGCAGGGG + Intronic
980241547 4:130183822-130183844 AGGCAAGAGAGATTGTGCAGGGG + Intergenic
980318245 4:131234224-131234246 TTGGAGAAGAGATTGGCCACAGG + Intergenic
981000673 4:139825869-139825891 AGGGAGAAGAGAGGAGGCATGGG + Intronic
981004512 4:139861288-139861310 AGGGAGAAGAGAATGAGTTGAGG - Intronic
981233215 4:142383791-142383813 AAGGAGAGGAGATTGAGAAGGGG + Intronic
981532207 4:145763830-145763852 GGGCAGAAGGGATTGGGGAGGGG - Intronic
982042527 4:151409597-151409619 AGGGAGCAGGCATTGGGCTGGGG + Intronic
982044373 4:151428509-151428531 AGGTAGAAGAGAGTGGCCTGGGG - Intronic
982126597 4:152189143-152189165 AGGGACCAGAGATGGGGGAGAGG - Intergenic
982180651 4:152745931-152745953 AGAGATAAGAGATTGGGGCGTGG + Intronic
982303636 4:153905929-153905951 AGGGAGAAGAGTGTGGATAGTGG - Intergenic
982740981 4:159056733-159056755 AGGGAAAATAGAATGAGCAGAGG + Intergenic
983396989 4:167211418-167211440 AAGGACAAGAGATTTGGAAGGGG + Intronic
984781909 4:183533795-183533817 AGAGATAAGAGATGAGGCAGGGG - Intergenic
985535060 5:459987-460009 GGGGAGAACAGATTAGGCAAGGG - Intronic
986161252 5:5231513-5231535 AGTGAGAAGAGCTTGGTCTGTGG - Intronic
986246434 5:6011518-6011540 AAGGACATGAGATTTGGCAGGGG - Intergenic
986341230 5:6791098-6791120 AGGGAGAGGAGATGGGGTTGTGG - Intergenic
986709645 5:10479516-10479538 AGTGAGAACAGGGTGGGCAGAGG + Intergenic
986761824 5:10886975-10886997 AGGCAGGAGAGCTTGTGCAGGGG + Intergenic
986763693 5:10903637-10903659 AGGCAGAGCAGATTGAGCAGTGG - Intergenic
987121951 5:14776089-14776111 AGGGAGCAGAGTGTGGGCAGGGG + Intronic
987197029 5:15536813-15536835 AGGGATACGAGATTTGGGAGGGG + Intronic
987457437 5:18164774-18164796 AGGCAGGAGAGCTTGTGCAGGGG + Intergenic
987486789 5:18535627-18535649 AGAGATAAGAGGTTGGGCTGTGG - Intergenic
987499034 5:18682025-18682047 AGGGACATGAGATTTGGGAGGGG + Intergenic
987934650 5:24448597-24448619 GGGGGGAAGAGATTGGCCAATGG - Intergenic
988224988 5:28402213-28402235 AGAGAGAAAAGATGGGGCAGGGG - Intergenic
988307233 5:29507898-29507920 AGGCAAAAGAGCTTGTGCAGGGG - Intergenic
988685245 5:33519341-33519363 AGGCAAGAGAGATTGTGCAGGGG - Intergenic
988739710 5:34058363-34058385 TGGGAGAAGAGAAAGGGAAGAGG + Intronic
989141583 5:38206826-38206848 AGAGAGAGGAGATGGGGAAGAGG - Intergenic
989333034 5:40281961-40281983 AGGGAGAAGAGATGGGGCTAGGG - Intergenic
989542342 5:42632022-42632044 AGGAAGGAGAGATGGGGCAGGGG - Intronic
990242101 5:53826111-53826133 AGGGAGAGGGAAATGGGCAGTGG + Intergenic
990887762 5:60614537-60614559 AAAGAGAAGAGATTAAGCAGGGG - Intronic
990995868 5:61731762-61731784 AGGGAGAAGAGAGAGGAAAGAGG + Intronic
991423344 5:66464268-66464290 AGGTAGAAAATAGTGGGCAGGGG + Intergenic
991669678 5:69035547-69035569 AGGACAAAGAGATTGGGGAGGGG + Intergenic
992380329 5:76229800-76229822 AGGGTGAAGAGGTTGGGGAGAGG + Intronic
993428330 5:87798890-87798912 AGGGAGACTAGATGGGGGAGTGG - Intergenic
993443089 5:87979657-87979679 AGGGAGAAGAGAGAGGGAGGAGG - Intergenic
993778590 5:92035518-92035540 AGGCAAAAGAGCTTGTGCAGGGG - Intergenic
994733243 5:103519753-103519775 AGGGAGAAGCAATTGACCAGTGG - Intergenic
994857454 5:105142646-105142668 AGGCAAAAGAGCTTGTGCAGGGG + Intergenic
995491186 5:112693068-112693090 TGGGTCAAGAGAGTGGGCAGTGG - Intergenic
995766189 5:115622450-115622472 AGGGAGAAGATATTGGGTAGTGG - Intronic
995856810 5:116601158-116601180 AGGGAGAGGAGGGAGGGCAGAGG - Intergenic
996033477 5:118732782-118732804 AGAGAAGAGAGATTGTGCAGGGG - Intergenic
996711906 5:126551807-126551829 AGGGAAACCAGATTGGGTAGTGG - Intronic
998293940 5:140946841-140946863 AAGGAGGAGAGATTGAGGAGAGG + Intronic
998415500 5:141943415-141943437 GGAGAGAAGAGAGTGGGCAGGGG - Intergenic
999272867 5:150307810-150307832 TGGGCAAACAGATTGGGCAGCGG - Intronic
999585190 5:153082081-153082103 AGGGAGAGGAGAAAGGGTAGAGG + Intergenic
999747644 5:154604440-154604462 AAGGAGCAGAGATAGGACAGTGG - Intergenic
999900833 5:156085400-156085422 AGGGAGAGGGGAGTGGGGAGAGG - Intronic
1000148114 5:158472815-158472837 AGGAAGATTGGATTGGGCAGGGG - Intergenic
1000949428 5:167462606-167462628 TTGGAGAAGAGATTGGCCATGGG - Intronic
1001191087 5:169631990-169632012 ATGGAGAAGAGATTGGAAGGAGG + Intergenic
1001456190 5:171862120-171862142 AGGGGGAAGGGAGGGGGCAGGGG - Exonic
1001594433 5:172888786-172888808 AGGCAGTGGAGATGGGGCAGAGG - Intronic
1001739760 5:174042803-174042825 AGGGGGAAGACATTGGTCAAAGG + Intergenic
1001762843 5:174222272-174222294 AGGGAGAAGAATTTGGGCTTGGG - Intronic
1001826059 5:174746021-174746043 AGGGAGAAGAAAGGGGACAGAGG - Intergenic
1002043038 5:176528275-176528297 AGGGAGAGGAGATTGGGCACGGG + Exonic
1002171185 5:177375397-177375419 AGGGAGAAGAGCATGCACAGAGG + Intergenic
1002189181 5:177469949-177469971 AGGGAGAAGAGAAAGAGGAGGGG + Intronic
1002594960 5:180316069-180316091 AGGGAGAAGCCACGGGGCAGGGG + Intronic
1002699034 5:181109694-181109716 AGGGAGGCGTGACTGGGCAGAGG + Intergenic
1003106340 6:3219328-3219350 AGGAAGCAGAGAATGGGCACTGG - Intergenic
1004167028 6:13265874-13265896 AGAGAGTAGAGAATGGGAAGAGG - Intronic
1004191808 6:13470640-13470662 AGGGAGAAGAGACAGAGAAGAGG + Intronic
1004374936 6:15082968-15082990 AGAGGGAAGAGAGTGGACAGTGG - Intergenic
1004691846 6:17998948-17998970 AGGGAGAAAAGGATGGGCAGTGG - Intergenic
1005100073 6:22162422-22162444 AGGGAGCAGAGATAGGGCAAAGG - Intergenic
1005223935 6:23620022-23620044 GGGGGGAAGAGATGGGGAAGAGG + Intergenic
1005605091 6:27468854-27468876 AGGGATAACTGACTGGGCAGAGG + Intronic
1005841172 6:29745456-29745478 AAGGAGGTGAGAGTGGGCAGTGG - Intergenic
1005944281 6:30584330-30584352 AGGTAGAGGAGATGGCGCAGGGG + Exonic
1006088993 6:31616687-31616709 AGGGGGAAGAGGAAGGGCAGGGG - Intronic
1006208171 6:32368869-32368891 AGTGAGAAGAGTTTGATCAGAGG - Intronic
1006455944 6:34131915-34131937 GGGGAGGAGAGAATGGGGAGAGG - Intronic
1006841683 6:37032367-37032389 AGGGAGGTGAGATGGGGCAAGGG - Intergenic
1006875972 6:37296661-37296683 AGGGAGTAGAGAATGGAGAGAGG - Intronic
1006931158 6:37689215-37689237 AGAGAGAAGGGATTGGGCTGAGG - Intronic
1007196731 6:40067738-40067760 AGGGACATGAGATTTGGGAGGGG + Intergenic
1007221300 6:40281156-40281178 AGGTAGAAGAGATGGGCCATAGG - Intergenic
1007375776 6:41455712-41455734 TGGGAGCAGAGATTGGGGTGAGG + Intergenic
1007691349 6:43703377-43703399 AGAGAGAAGTGATTGCACAGGGG - Intergenic
1007716876 6:43861848-43861870 AGGGAGCAGGGATAGGGCAGGGG + Intergenic
1007836455 6:44677626-44677648 AGGCAGAAGAGATATGGCTGAGG - Intergenic
1008395340 6:51000078-51000100 TGGGTGAAAAGATTGGGGAGGGG - Intergenic
1008638517 6:53436765-53436787 AGTGACAAGAGATTGGAGAGTGG + Intergenic
1009284859 6:61803984-61804006 AGGAAGATGAGATTTGGGAGGGG - Intronic
1009374856 6:62954706-62954728 AGGCAAGAGAGCTTGGGCAGGGG + Intergenic
1009620136 6:66064466-66064488 AGGGATATGAGATTTGGGAGGGG + Intergenic
1009891925 6:69695393-69695415 AGTGAGAAGAGAATGGACACTGG - Intronic
1010012282 6:71062181-71062203 AATGAGAAGAGGTTGGTCAGCGG - Intergenic
1012580599 6:100865108-100865130 AGGGGGAGGAGAATGGGCAAAGG + Intronic
1012586472 6:100928904-100928926 AGGGAGAACAGAGAGTGCAGTGG + Intergenic
1012605329 6:101151447-101151469 AGGGAGAAGAGACTGGGAGGGGG + Intergenic
1012673359 6:102085277-102085299 AGGAAGAGGAGATTGGGTGGGGG - Intergenic
1012832951 6:104228749-104228771 AGGCAAAAGAGCTTGTGCAGGGG - Intergenic
1013315593 6:108939473-108939495 AGGAAGAAGAGAGAGAGCAGGGG - Intronic
1013602616 6:111719346-111719368 AGGAAGAAGTGAGTGGGAAGAGG + Intronic
1013706064 6:112835500-112835522 AAGGAGAAGAGATAGGTAAGTGG + Intergenic
1013794400 6:113869510-113869532 AGGGAAAAGAGCTTGTGCTGGGG - Intergenic
1013887457 6:114987730-114987752 AGGGACATGAGATTTGGGAGGGG - Intergenic
1013961689 6:115908683-115908705 AGAGAGAAGAGAATGTGGAGAGG + Intergenic
1014668809 6:124273146-124273168 AGGGACATGAGATTTGGAAGAGG + Intronic
1015160431 6:130147082-130147104 AGGGGGAAGAGTTCAGGCAGTGG - Intronic
1015235134 6:130962260-130962282 AGGCAGGAGAGGTGGGGCAGAGG + Intronic
1015758443 6:136631906-136631928 ATGGAGAAGAGCTAGGCCAGAGG + Intronic
1015851140 6:137573933-137573955 AGGAGGAGGAGATTGGGAAGGGG + Intergenic
1017281546 6:152631273-152631295 AGGGTGAAGAGCTTGAGCAAAGG + Intronic
1017904009 6:158743530-158743552 AGATAGAAGAGAATGGACAGAGG - Intronic
1018293455 6:162317337-162317359 AGGCAGGAGAGCTTGTGCAGGGG - Intronic
1018431802 6:163728799-163728821 AGGGAAAAGACAATGGGAAGTGG - Intergenic
1018981495 6:168605073-168605095 AGTGAGGAGAGAATGGGAAGGGG + Intronic
1019434479 7:1015087-1015109 AGGCTGGAGAGACTGGGCAGGGG - Intronic
1019448294 7:1082725-1082747 AGGGTTACGAGATGGGGCAGTGG - Intronic
1019629969 7:2043782-2043804 TGGGAGGAGAGAATGGGCAGAGG - Intronic
1019702652 7:2481479-2481501 AGGCAGCAGAGATTGGGGTGGGG - Intergenic
1019735682 7:2648797-2648819 AGCGAGGAGGGATTGAGCAGGGG + Intronic
1020233750 7:6339839-6339861 AAGGAGAGGAGAGTGTGCAGAGG + Intronic
1020553139 7:9633430-9633452 AGGAAGAACAGGTTTGGCAGAGG - Intergenic
1020606455 7:10344009-10344031 AGGCAGAGGAGAATGGACAGCGG - Intergenic
1020965955 7:14868615-14868637 AGTGAGAAGAAATTGGGATGAGG - Intronic
1022029756 7:26481431-26481453 GGGGAGAAAAGACTGGGCAAGGG - Intergenic
1022341827 7:29475875-29475897 GAGGAGAAGAGAATGAGCAGTGG + Intronic
1022376112 7:29813049-29813071 ACGGAGGAGAGAGTGGGAAGCGG - Intronic
1022484217 7:30765557-30765579 TGGGAGCAGAGATTGGGATGTGG + Intronic
1022978118 7:35576984-35577006 AGGCAAAAGAGCTTGTGCAGGGG + Intergenic
1023325858 7:39055044-39055066 AGAGAGAATAGATTGGAAAGGGG + Intronic
1023991967 7:45133897-45133919 AGGTACAAGAGAAGGGGCAGAGG - Intergenic
1024532371 7:50404535-50404557 AGGGAGAAGAGATGGGCCTCAGG + Intronic
1025108976 7:56196868-56196890 AGGGAGAGGGGACAGGGCAGGGG - Intergenic
1026028117 7:66763633-66763655 AGGGATAAGAGAAAGGGCATGGG - Intronic
1026118354 7:67515278-67515300 AAGAAGAAGAGATTGGACATTGG - Intergenic
1026451072 7:70530130-70530152 AGGGAGGGAAGATTGGGAAGGGG + Intronic
1026552896 7:71382764-71382786 AAAGAGAAGGAATTGGGCAGGGG + Intronic
1027224893 7:76237645-76237667 AGGGAGGGGAGTGTGGGCAGAGG + Intronic
1027392408 7:77718028-77718050 AGGGAGAAGAGATGTAGGAGAGG + Intronic
1027953787 7:84854716-84854738 AGGGACATGAGATTTGGGAGGGG - Intergenic
1028150521 7:87366306-87366328 AGGGAAAACAGAAAGGGCAGAGG - Intronic
1028455061 7:91029611-91029633 GGGGAGAGGAGAGTGGGGAGCGG - Intronic
1028559581 7:92159493-92159515 AGGGAGAAGAGAATGGGATAAGG - Intronic
1029019142 7:97345936-97345958 AAAGAGAAAAGATTGGGCACTGG - Intergenic
1029121436 7:98270711-98270733 GGGGAGAAGGGATGGGGGAGTGG + Intronic
1029678675 7:102092219-102092241 AGGGAAAAGAGATCTGGGAGAGG - Intronic
1030117602 7:106074056-106074078 AGGGAGGAGAGATAGGCCATTGG + Intergenic
1030341387 7:108384521-108384543 AAGGAAAGGAGATTTGGCAGAGG + Intronic
1030513799 7:110517341-110517363 GAGGGGAAAAGATTGGGCAGAGG - Intergenic
1031207598 7:118780655-118780677 AGGGAGAAGTGGATGTGCAGTGG - Intergenic
1031914303 7:127547907-127547929 ATGGAGATGAGATTTGGGAGGGG - Intergenic
1031998522 7:128248783-128248805 AGTGGGAAGGGATGGGGCAGAGG - Intronic
1032558622 7:132864293-132864315 AGGGAAAAGAGATGGGGAAATGG + Intronic
1032650379 7:133871645-133871667 AAGGAGAAGAGGATGGGAAGTGG - Intronic
1032696635 7:134342393-134342415 AGGCAAGAGAGATTGTGCAGAGG + Intergenic
1032945454 7:136846821-136846843 GGGGAGGAGTAATTGGGCAGTGG + Intergenic
1033192270 7:139292260-139292282 AGGGGGCGGAGTTTGGGCAGGGG + Intronic
1033254238 7:139785778-139785800 TGGGAGATGAGATTGGGAAGGGG - Intronic
1033415640 7:141159092-141159114 AGGCAGGAGAGGTTGGGAAGGGG - Intronic
1033501701 7:141957534-141957556 AGGCAAAAGAGATTGTGTAGGGG + Intronic
1033773329 7:144578502-144578524 AGGGAAGAGAGAGTGTGCAGAGG - Intronic
1033969773 7:147025326-147025348 AGGGAGAAGAAAGGGGGGAGGGG + Intronic
1033969868 7:147025507-147025529 GGGGAGAAGAAAGTGGGGAGGGG + Intronic
1034012989 7:147550397-147550419 AGGCAAGAGAGATTGTGCAGGGG - Intronic
1034137783 7:148787505-148787527 AGGCAGAGGAGTTTGTGCAGTGG + Intronic
1034268085 7:149790789-149790811 AGGGATAAGAGGGTGGGCAGAGG + Intergenic
1034453626 7:151151713-151151735 AGGGAGAAAGGATTGGGCTCTGG - Intronic
1034459527 7:151190902-151190924 AGGGTAAAGGGATGGGGCAGAGG - Exonic
1035149765 7:156860298-156860320 AAAGAGAAGAGTTTGTGCAGGGG + Intronic
1036218843 8:6903630-6903652 AGGGGGAAGAGAAAGGACAGGGG + Intergenic
1036502704 8:9328361-9328383 GGGAAGAAGAGATGGGGCAAAGG - Intergenic
1036682505 8:10885840-10885862 AGGGAGAAGAGATGGAGGGGAGG + Intergenic
1036798460 8:11772402-11772424 AGGAAGAAGTGCTTGAGCAGGGG - Intronic
1037108911 8:15142666-15142688 AGTGAGATGAGATTGGGGGGTGG - Intronic
1037383039 8:18308702-18308724 GGGGAGAAGGGAATGGGGAGTGG + Intergenic
1037711888 8:21361419-21361441 GGGTAGAAGGCATTGGGCAGAGG - Intergenic
1037714509 8:21385760-21385782 AGTCAGAAGACATTGGTCAGGGG + Intergenic
1037879073 8:22564347-22564369 AGGAACTAGAGACTGGGCAGAGG + Exonic
1038228061 8:25674827-25674849 ATGGGGAAGAGAGTGGGGAGAGG + Intergenic
1038280035 8:26155755-26155777 AAGGAGATGGGATTAGGCAGAGG + Intergenic
1038348501 8:26754828-26754850 ATGGAGCAGAGGTGGGGCAGGGG - Intronic
1038617719 8:29110514-29110536 AGGGAGAAGATAGTGGACATAGG + Intronic
1038629997 8:29232822-29232844 AGGGGTGAGAGAGTGGGCAGTGG - Intronic
1038848780 8:31254486-31254508 AGGGAGTGGGGAATGGGCAGGGG - Intergenic
1038922507 8:32100131-32100153 AGGAAGAAGAGAGGAGGCAGAGG - Intronic
1039079419 8:33721102-33721124 AAGAAGAAGAGATTGAGCTGGGG - Intergenic
1039411429 8:37358277-37358299 CGGGGGAAGAGATTGGAGAGAGG + Intergenic
1039557592 8:38487773-38487795 AGGGAGAGGAGATTGCACAGAGG - Intergenic
1040021636 8:42746101-42746123 AGGCAGCAGAAAGTGGGCAGAGG - Intergenic
1040577390 8:48665932-48665954 AGAGAGAAGAGCCTGTGCAGAGG + Intergenic
1041044594 8:53878783-53878805 AGGGAGATGGGAAAGGGCAGGGG + Intronic
1041289652 8:56296828-56296850 GGGGAGAAGAGAAGGGGAAGAGG - Intergenic
1041977508 8:63816887-63816909 AGGGACATGAGATTTGGGAGGGG - Intergenic
1042266189 8:66911098-66911120 AGGGACATGAGATTTGGGAGGGG + Intronic
1042289700 8:67156516-67156538 TGGGAGAAGAGATTTTGAAGAGG - Intronic
1042361940 8:67893626-67893648 AGGGAAGAGAGCTTGGGCAGGGG + Intergenic
1043125366 8:76387795-76387817 AGGGAGACAGCATTGGGCAGGGG + Intergenic
1043508477 8:80926116-80926138 AGGGAGGAGAGAGTGGGAGGTGG - Intergenic
1043515865 8:80994057-80994079 AGGGAGATGAGAGATGGCAGTGG - Intronic
1043515874 8:80994109-80994131 AGGGAGATGAGAGATGGCAGTGG - Intronic
1043515879 8:80994134-80994156 AGGGAGATGAGAGATGGCAGTGG - Intronic
1044564952 8:93652808-93652830 AGGCAGGAGAGTTTGTGCAGGGG - Intergenic
1045423875 8:102043693-102043715 AGGAGGAAGAGAAGGGGCAGGGG + Intronic
1045900042 8:107267122-107267144 AGGGAGATGAAATGGGGCTGTGG - Intronic
1045932579 8:107644224-107644246 AGGCAGGAGAGCTTGTGCAGGGG - Intergenic
1045942767 8:107757435-107757457 AGGGAGAAGAGAAAGTGAAGGGG - Intergenic
1046134039 8:110003762-110003784 AGGGACATGAGATTTGGAAGGGG - Intergenic
1046291853 8:112172628-112172650 AGGGAGAGTAGAGTGTGCAGTGG - Intergenic
1046357031 8:113100901-113100923 ATGGAGCAGAGGTGGGGCAGAGG + Intronic
1046367107 8:113249121-113249143 AGGCAAAAGAGGTTGTGCAGGGG - Intronic
1047054231 8:121146271-121146293 GGCGAGAAGAGCTTGTGCAGGGG - Intergenic
1047327920 8:123857780-123857802 AGGAAGAGGAGAGAGGGCAGTGG - Intronic
1047502764 8:125454670-125454692 AGGGGGAAGAGCATGGCCAGAGG + Intergenic
1047649137 8:126900727-126900749 AGGGACAACAGATTTGGGAGGGG + Intergenic
1047679096 8:127235707-127235729 AGGGAAACAGGATTGGGCAGAGG - Intergenic
1048417609 8:134243884-134243906 AAGGAGAAGAGAAGGGGAAGGGG + Intergenic
1048884853 8:138901865-138901887 AAGGAGAAGACAATGGGAAGAGG + Intronic
1049409647 8:142466742-142466764 AGGGAGTAGAGATGGGGTGGTGG + Intronic
1049839431 8:144761624-144761646 AGAGAGAAGAGAGGGGGTAGAGG - Intergenic
1049873443 8:144999774-144999796 AGGGAGAAGATATTAGGCTCAGG + Intergenic
1049893212 9:90211-90233 AGGGAGAATACATAGGGGAGGGG - Intergenic
1049961135 9:739380-739402 GAGCAGAAGAGATTGGACAGTGG - Intronic
1050376822 9:4983086-4983108 AGGGAGAAGCCATTTGGAAGTGG - Intergenic
1050681647 9:8118399-8118421 ATGGAGAAGAAACTGGGCAGGGG - Intergenic
1050731717 9:8716710-8716732 AGGAAGAAGAGAATGGGTGGTGG + Intronic
1050898124 9:10909804-10909826 AAGGAAAAGAGATTGGCCTGGGG + Intergenic
1052008970 9:23383512-23383534 AAGGACATGAGATTTGGCAGGGG + Intergenic
1052142625 9:25005174-25005196 AAGGAAAAGGGATTGGGGAGGGG + Intergenic
1052179088 9:25502629-25502651 AGGGACATGAGATTTGGGAGGGG + Intergenic
1052218198 9:25991384-25991406 AGAGAAAAGAGCTTGTGCAGGGG + Intergenic
1053286446 9:36852388-36852410 AAGGAGAAGGGACTTGGCAGAGG + Intronic
1053295391 9:36909456-36909478 AGGTAGAATAGCTTGAGCAGAGG + Intronic
1053734423 9:41090265-41090287 AGGGAGAATACATAGGGGAGGGG - Intergenic
1054693963 9:68341308-68341330 AGGGAGAATACATAGGGGAGGGG + Intronic
1054726033 9:68651099-68651121 AAGGAGAAGAAATGGGACAGTGG - Intergenic
1055403839 9:75953306-75953328 AGGGAAAAGAGATAGGGAGGAGG + Intronic
1055762507 9:79624039-79624061 AGAGAGGACAGATTGGGGAGGGG + Intronic
1056032128 9:82564001-82564023 AGGAAGAAGAGAGTGAGGAGAGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056435108 9:86568491-86568513 AGGAAGGCAAGATTGGGCAGAGG + Intergenic
1056684639 9:88749394-88749416 AGGGAGGAGACAATGGGCACAGG + Intergenic
1056781299 9:89553178-89553200 AGAGAGAAGAGACAGGGCTGGGG - Intergenic
1056841161 9:89999009-89999031 AGGGAGGAGAGATTTGGGAGTGG + Intergenic
1057129272 9:92641905-92641927 AGGGAAAGGAGATTGGAAAGAGG + Intronic
1057164245 9:92913736-92913758 AGAGAGGAGGGATTGGGCAATGG - Intergenic
1057197000 9:93120903-93120925 GGGGAGAACAGAATGGGTAGTGG + Intergenic
1057233412 9:93339274-93339296 AGGGACATGAGATTTGGGAGAGG + Intronic
1057390871 9:94640489-94640511 GGGGAGAAGAGGGTGAGCAGAGG + Intergenic
1058079836 9:100690075-100690097 AGAGAAGAGAGTTTGGGCAGAGG + Intergenic
1058333243 9:103791383-103791405 AGGAGGAAGAGATTGAGGAGAGG - Intergenic
1058769929 9:108220832-108220854 AGGGAAAAGAGATTGAGATGGGG - Intergenic
1058906832 9:109488885-109488907 AGGCAGAAGAGGATGGGCATTGG - Intronic
1059069917 9:111124673-111124695 AGTGAGAAGAGAGTTGCCAGTGG + Intergenic
1059341731 9:113601211-113601233 AGTGGGAAGAGTTTGGGGAGGGG - Intergenic
1059416204 9:114163972-114163994 AGGGTGAAGAGATGGGGGACAGG - Intronic
1060036641 9:120261540-120261562 AGGGAGAAGGCAGAGGGCAGTGG + Intergenic
1060202603 9:121660439-121660461 AGGGAGAAGAAAGTGGGAAGAGG + Intronic
1060212761 9:121720592-121720614 AGGGAGCAGGGAGTGGGCAGTGG - Intronic
1060505915 9:124198444-124198466 AGTAAGAAGAGAGTAGGCAGCGG - Intergenic
1060743445 9:126114364-126114386 AGGAAGAAAAGAAGGGGCAGGGG - Intergenic
1060777197 9:126383683-126383705 AGAGAGAACAGATGGGGGAGGGG + Intronic
1061278299 9:129582216-129582238 AGGGAAGAGAGGTTGGGGAGGGG - Intergenic
1061793492 9:133070958-133070980 AGTGAGAAGAGGCTGTGCAGGGG - Intronic
1061796100 9:133086757-133086779 AGTGAGAAGAGGCTGTGCAGGGG - Intronic
1062584360 9:137242223-137242245 AGGGAGCTGAGCTGGGGCAGTGG + Intronic
1185581202 X:1212898-1212920 AGGGGGAGGAGATGGGGGAGGGG - Intergenic
1185797605 X:2980383-2980405 AGGCAGCAGAGCTTGTGCAGGGG - Intergenic
1185937024 X:4269256-4269278 AGGGAGAGGTTATTGGGAAGTGG + Intergenic
1186143905 X:6605763-6605785 TGGGAGAAGAAATTGGGGGGTGG + Intergenic
1186244402 X:7605507-7605529 AGGAAGAAGAGATGGGGTGGAGG - Intergenic
1186644863 X:11495690-11495712 AAAGGGAAGAGATTGGGTAGGGG - Intronic
1186855968 X:13626283-13626305 AGGAAGAAGACATTGGGGAATGG - Intronic
1187204110 X:17165747-17165769 AGGGAGGAGAGGTTGGGTGGTGG + Intergenic
1187554516 X:20339281-20339303 AGGGAGATGTGATTTGTCAGAGG - Intergenic
1187711332 X:22057611-22057633 AGGGATTGGAGATTGGGTAGGGG - Intronic
1187946773 X:24433776-24433798 AAGGTGAAAAGATTGGGAAGAGG + Intergenic
1188090547 X:25959254-25959276 AGGCAAAAGAGCTTGTGCAGGGG - Intergenic
1188616620 X:32165672-32165694 AGGGACATGAGATTTGGGAGGGG + Intronic
1188827838 X:34858237-34858259 AGGGAGAAAGGATTTGGCAATGG + Intergenic
1188859267 X:35237762-35237784 TGAGGGAAGAGGTTGGGCAGAGG + Intergenic
1189032218 X:37462415-37462437 AGGGAAAACAGAATGGGTAGTGG - Intronic
1189097758 X:38158110-38158132 AAGGGTAAGAGAATGGGCAGTGG + Intronic
1189667741 X:43375555-43375577 AAGGAGGCAAGATTGGGCAGAGG - Intergenic
1189809066 X:44764180-44764202 AGGAAGAAGTGATGGGGGAGGGG - Intergenic
1190712044 X:53078378-53078400 AGGGAGAAGAGACTGGGCTTGGG - Exonic
1191834262 X:65447108-65447130 AGGGAGATTAGATTGGGAAGGGG - Intronic
1191857974 X:65642975-65642997 AGGGAGAAGCGAGTGGGATGGGG - Intronic
1192206210 X:69098168-69098190 AGGGAGAGAGGATGGGGCAGTGG - Intergenic
1192206991 X:69102923-69102945 AAGGAGAGGAGAGTGGGGAGAGG - Intergenic
1192272990 X:69601062-69601084 AAGAAGAAGAGATTGGGTAAGGG + Intergenic
1192868804 X:75165455-75165477 AAGGATAAGAGATTGGGGACTGG + Intergenic
1194135089 X:90131093-90131115 AGGGACATGAGATTTGGGAGGGG + Intergenic
1194293791 X:92104811-92104833 AGAGATAAGAGATTGGGGCGTGG + Intronic
1194351113 X:92825615-92825637 AGAGATAAGAGATTGGGGCGTGG - Intergenic
1194424864 X:93723799-93723821 AGGGAAAGTTGATTGGGCAGTGG + Intergenic
1194456013 X:94104576-94104598 AAGGAGATGAGATTTGGTAGGGG - Intergenic
1194660499 X:96625084-96625106 AGAGATAAGAGGTTGGGCCGTGG - Intergenic
1195643377 X:107202103-107202125 AAGGAAATGAGATTGGGAAGGGG + Intronic
1195668837 X:107452476-107452498 AGGGAGAGGAGACTGGCCAGGGG + Intergenic
1195941154 X:110169093-110169115 ATGGATAAGAGCATGGGCAGTGG - Intronic
1196761297 X:119203011-119203033 AGGCATAAGAAATTGGGTAGGGG + Intergenic
1196812454 X:119639614-119639636 AGGGGGATGAGATTGGGAAAGGG - Intronic
1196883738 X:120223733-120223755 AGGGAAAAGAGAACAGGCAGTGG + Intergenic
1196996391 X:121388480-121388502 AGGGACAAGAGATTTGGGAGGGG + Intergenic
1198077851 X:133211706-133211728 AGGGAGAAAAAATAGGGCTGGGG + Intergenic
1198254819 X:134915339-134915361 AGGAAGAAGAGGTGGGGCTGGGG + Intergenic
1198966988 X:142237686-142237708 AGGGACATGAGATTTGGGAGGGG + Intergenic
1199061570 X:143361619-143361641 AGGGACATGAGATTTGGGAGGGG - Intergenic
1199200967 X:145088456-145088478 AGGGACATGAGATTTGGGAGGGG + Intergenic
1199327268 X:146513729-146513751 AGGGACATGAGATTTGGGAGGGG + Intergenic
1199458845 X:148060368-148060390 AGGCAAAAGAGCTTGAGCAGGGG + Intergenic
1199498098 X:148476554-148476576 AGGGAGAAGAGAGTTGGAAATGG - Intergenic
1199659515 X:150034700-150034722 AGGGAGAAGAGTATGTGGAGGGG + Intergenic
1199944220 X:152652675-152652697 AGAGAGAAGTGAGTGGGCTGAGG - Exonic
1200174373 X:154102438-154102460 GGGGAGAGGAGGATGGGCAGAGG + Intergenic
1200215807 X:154367805-154367827 AGGCAGGAGAGACTGGGCTGGGG - Intronic
1200216707 X:154371345-154371367 AGGGAGCAGAGGTTGCGCTGCGG + Exonic
1200480871 Y:3701184-3701206 AGGGACATGAGATTTGGGAGGGG + Intergenic
1200611310 Y:5329352-5329374 AGAGATAAGAGATTGGGGCGTGG + Intronic
1200851941 Y:7892214-7892236 AGGGAGATGGGATTCAGCAGTGG + Intergenic
1201253832 Y:12087949-12087971 AGAGAGAAGAGATAAGGGAGAGG - Intergenic
1201586341 Y:15565055-15565077 AAGAAGAAGACATTGGGTAGTGG + Intergenic